Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,858 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
AiP1011-pAAV-mscRE4-minBGpromoter-tTA2-WPRE-hGHpA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_163480 tTA2 Synthetic Ampicillin PMID:33789083 Funded by BRAIN initiative. Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGprom-IRES2-tTA2-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:09:12 2
AiP1037-pAAV-mscRE13-minBGpromoter-FlpO-WPRE-hGHpA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_163474 FlpO Synthetic Ampicillin PMID:33789083 Funded by BRAIN initiative. Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGpromoter-FlpO-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:09:12 1
AiP1036-pAAV-mscRE10-minBGpromoter-FlpO-WPRE-hGHpA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_163473 FlpO Synthetic Ampicillin PMID:33789083 Funded by BRAIN initiative. Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGpromoter-FlpO-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:09:12 1
AiP1010-pAAV-mscRE4-minBGpromoter-iCre-WPRE-hGHpA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_163476 iCre Synthetic Ampicillin PMID:33789083 Funded by BRAIN initiative. Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGprom-IRES2-FlpO-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:09:12 2
AiP1038-pAAV-mscRE16-minBGpromoter-FlpO-WPRE-hGHpA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_163475 FlpO Synthetic Ampicillin PMID:33789083 Funded by BRAIN initiative. Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGpromoter-FlpO-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:09:12 1
AiP1045-pAAV-mscRE10-minBGpromoter-iCre-WPRE-hGHpA
 
Resource Report
Resource Website 		RRID:Addgene_163477 iCre Synthetic Ampicillin PMID:33789083 Funded by BRAIN initiative. Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGpromoter-iCre-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:09:12 0
AiP1047-pAAV-mscRE16-minBGpromoter-iCre-WPRE-hGHpA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_163479 iCre Synthetic Ampicillin PMID:33789083 Funded by BRAIN initiative. Backbone Marker:Allen Institute; Vector Backbone:pAAV-mscRE4-minBGpromoter-iCre-WPRE-hGHpA; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:09:12 1
L4062
 
Resource Report
Resource Website 		RRID:Addgene_1636 Ampicillin See Fire Lab Vector Kit Documentation 1999. Fire Lab Miniprep Number pPD122.64, Ligation number L4062. Backbone Size:6850; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:13 0
pCAFNF-EGFP
 
Resource Report
Resource Website 		RRID:Addgene_163609 Egfp Aequorea victoria Ampicillin PMID:34161760 Vector Backbone:pCAFNF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:13 0
pCAFNF-LifeAct-EGFP
 
Resource Report
Resource Website 		RRID:Addgene_163608 LifeAct Synthetic Ampicillin PMID:34161760 Vector Backbone:pCAFNF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:13 0
pCAFNF-Rhoa
 
Resource Report
Resource Website 		RRID:Addgene_163605 Rhoa Mus musculus Ampicillin PMID:34161760 Backbone Size:6061; Vector Backbone:pCAFNF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:13 0
pCAFNF-Cdc42
 
Resource Report
Resource Website 		RRID:Addgene_163606 Cdc42 Mus musculus Ampicillin PMID:34161760 Vector Backbone:pCAFNF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:13 0
pCMV_RBMX-eA3A-UdgX-HF-NG-nCas9
 
Resource Report
Resource Website 		RRID:Addgene_163550 RBMX-eA3A-UdgX-HF-NG-nCas9 Homo sapiens Ampicillin PMID:34183861 Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin nCas9 (D10A)N497A, R661A, Q695A, Q926A//L111R, D1135V, G1218R, E1219F, A1322R, R1335V, T1337R 2026-08-15 01:09:13 0
Dcp2 ΔH1 Δ5H
 
Resource Report
Resource Website 		RRID:Addgene_163582 Dcp2 Saccharomyces cerevisiae Ampicillin PMID:32553117 Impaired Edc3 binding sites (first HLM, and 5 additional HLMs in C-terminal domain). 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin L255A; mutate 440-450, 489-500, 701-708, 827-831, and 935-938 to all alanines 2026-08-15 01:09:13 0
Dcp2C Δ5H
 
Resource Report
Resource Website 		RRID:Addgene_163581 Dcp2 Saccharomyces cerevisiae Ampicillin PMID:32553117 C-terminal domain (327-970) containing 5 impaired Edc3 binding sites (5 additional HLMs in C-terminal domain); N-terminal domain (1-299) including first HLM is removed. 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Truncation of aa1-300; mutate aa440-450, aa489-500, aa701-708, aa827-831, and aa935-938 to all alanines 2026-08-15 01:09:13 0
N-GFP-Dcp2
 
Resource Report
Resource Website 		RRID:Addgene_163585 Dcp2 Saccharomyces cerevisiae Ampicillin PMID:32553117 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:13 0
Dcp2 ΔH1 WD
 
Resource Report
Resource Website 		RRID:Addgene_163580 Dcp2 Saccharomyces cerevisiae Ampicillin PMID:32553117 Impaired Edc3 binding site (first HLM); impaired RNA cap recognition site (W50, D54). 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin W50A, D54A, L255A 2026-08-15 01:09:13 0
pGEX4T3-NL2CT
 
Resource Report
Resource Website 		RRID:Addgene_163623 mouse NL2 Mus musculus Ampicillin PMID:31775031 Vector Backbone:pGEX4T3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:14 0
plenti_DCLK1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_163625 DCLK1 Homo sapiens Ampicillin PMID:32755567 Please note that the Addgene NGS sequence differs from the depositor's annotated sequence. These differences do not affect plasmid function. Vector Backbone:pLenti6; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:09:14 1
plenti_DCLK1 G511N
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_163626 DCLK1 Homo sapiens Ampicillin PMID:32755567 Please note that the Addgene NGS sequence differs from the depositor's annotated sequence. These differences do not affect plasmid function. Vector Backbone:pLenti6; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin G511N 2026-08-15 01:09:14 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch