Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pMEND-Lx
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25010 pMEND-Lx Kanamycin PMID:20434484 Backbone Size:8798; Vector Backbone:pMINDLx; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:36 1
CMV-miR-31 sponge
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25025 CMV-miR-31 sponge Ampicillin PMID:19524507 miR-31 sponge generated by cloning oligonucleotides containing seven tandem “bulged” (at positions 9-12) miR-31 binding motifs (AGGCAAGACGAGGCATAGCT) into the XhoI and ApaI sites of the CMV sponge backbone. Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA5-CMV-d2eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:37 1
PP-SRM
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25110 PF11_0301:C22904 Plasmodium falciparum Ampicillin PDB: 2PT9. http://www.thesgc.org/structures/2PT9/ . Backbone Marker:SGC; Backbone Size:7746; Vector Backbone:p15TV-L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:12:39 1
pET28a-pro-sumo3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25103 pro-SUMO3 Homo sapiens Kanamycin PMID:17591783 Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin changed Serine 2 to Alanine 2026-08-15 01:12:37 1
pET28a-pro-sumo2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25102 pro-SUMO2 Homo sapiens Kanamycin PMID:17591783 Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:37 2
2XMyc-LRRK2-RCK
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25065 LRRK2 Homo sapiens Kanamycin PMID:18397888 An additional Myc tag has been added to the original vector. The 2XMyc vector was adapted to the invitrogen gateway system by insertion of a gateway cloning cassette. LRRK2 was cloned by gateway recombination. Backbone Marker:Cookson Lab; Backbone Size:4300; Vector Backbone:pCMV-Tag 3B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Contains only the ROC-COR-Kinase domains aa 1329-2219 2026-08-15 01:12:36 2
CBX2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25158 CBX2_04 Homo sapiens Kanamycin For more information, please see: http://www.thesgc.org/structures/3H91/ http://www.thesgc.org/structures/5EPK/ Backbone Marker:SGC (Addgene Plasmid # 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:39 2
KRASB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25153 KRASb:M1-K169 Homo sapiens Kanamycin PDB: 3GFT. http://www.thesgc.org/structures/3GFT/ Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Q61H 2026-08-15 01:12:37 1
NEDD4L
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25169 nedd4l.0574.0947 Homo sapiens Kanamycin PDB: 2ONI. http://www.thesgc.org/structures/2ONI/ Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Hect Domain 2026-08-15 01:12:38 2
EPHA3 (2GSF)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25136 epha3.577.947 Homo sapiens Kanamycin PDB: 2GSF. http://www.thesgc.org/structures/2GSF/ . Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:37 1
USP21 (3I3T)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25147 usp21.209.563 Homo sapiens Kanamycin PDB: 3I3T. http://www.thesgc.org/structures/3I3T/ Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:39 1
UBC47
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_25145 ubc47.001.193 Homo sapiens Kanamycin PDB: 3BZH. http://www.thesgc.org/structures/3BZH/ Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC notag; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:37 1
pEVOL-pAzF
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_31186 M.j. p-azidohenylalanine RS (2 copies +tRNA) M.jannaschii Chloramphenicol PMID:12148987 Backbone Size:5000; Vector Backbone:p15A; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol Y32T, E107N, D158P, I159L, L162Q, D286R 2026-08-15 01:13:33 52
pDEST-HemmarR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31222 CD4-tdTom Homo sapiens Chloramphenicol and Ampicillin PMID:21606367 Gateway destination vector for cloning any enhancer to drive expression of membrane marker CD4-tdTom The depositing laboratory recommends growing bacteria either on LB plates with 80 ug/ml Carbenicillin or in LB liquid media with 60 ug/ml Carbenicillin (a semi-synthetic ampicillin analog) Backbone Size:10193; Vector Backbone:pAPIC-HIH; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin Fusion of signal peptide of Drosophila Akh gene, human CD4 transmembrane domain, tdTomato, and Kir2.1 ER exit signal. 2026-08-15 01:13:33 2
pKEB31
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31224 ccdB and Cm resistance gene Chloramphenicol PMID:21493687 Backbone Size:12617; Vector Backbone:pDD62; Vector Types:; Bacterial Resistance:Chloramphenicol 2026-08-15 01:13:33 2
pQCXI Puro DsRed-LC3-GFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_31182 DsRed-LC3-GFP Ampicillin PMID:21575862 DsRed-LC3-GFP autophagy reporter plasmid. The LC3 gene is from rat. Backbone Marker:Clontech; Backbone Size:7100; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:32 13
pLenti6/V5-DEST-MCM7
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31212 MCM7 Homo sapiens Ampicillin PMID:21741599 Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:29 3
pLenti6/V5-DEST-NCAPH
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31214 NCAPH Homo sapiens Ampicillin PMID:21741599 Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:33 1
pQTEV
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31291 Ampicillin PMID:14739323 The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence. Backbone Marker:Qiagen; Backbone Size:4803; Vector Backbone:pQE-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:34 2
pLenti6/V5-DEST-RNF2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31216 RNF2 Homo sapiens Ampicillin PMID:21741599 Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:33 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch