Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pMEND-Lx Resource Report Resource Website 1+ mentions |
RRID:Addgene_25010 | pMEND-Lx | Kanamycin | PMID:20434484 | Backbone Size:8798; Vector Backbone:pMINDLx; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:36 | 1 | |||
|
CMV-miR-31 sponge Resource Report Resource Website 1+ mentions |
RRID:Addgene_25025 | CMV-miR-31 sponge | Ampicillin | PMID:19524507 | miR-31 sponge generated by cloning oligonucleotides containing seven tandem “bulged” (at positions 9-12) miR-31 binding motifs (AGGCAAGACGAGGCATAGCT) into the XhoI and ApaI sites of the CMV sponge backbone. | Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA5-CMV-d2eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:37 | 1 | ||
|
PP-SRM Resource Report Resource Website 1+ mentions |
RRID:Addgene_25110 | PF11_0301:C22904 | Plasmodium falciparum | Ampicillin | PDB: 2PT9. http://www.thesgc.org/structures/2PT9/ . | Backbone Marker:SGC; Backbone Size:7746; Vector Backbone:p15TV-L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:12:39 | 1 | ||
|
pET28a-pro-sumo3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25103 | pro-SUMO3 | Homo sapiens | Kanamycin | PMID:17591783 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | changed Serine 2 to Alanine | 2026-08-15 01:12:37 | 1 | |
|
pET28a-pro-sumo2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25102 | pro-SUMO2 | Homo sapiens | Kanamycin | PMID:17591783 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:37 | 2 | ||
|
2XMyc-LRRK2-RCK Resource Report Resource Website 1+ mentions |
RRID:Addgene_25065 | LRRK2 | Homo sapiens | Kanamycin | PMID:18397888 | An additional Myc tag has been added to the original vector. The 2XMyc vector was adapted to the invitrogen gateway system by insertion of a gateway cloning cassette. LRRK2 was cloned by gateway recombination. | Backbone Marker:Cookson Lab; Backbone Size:4300; Vector Backbone:pCMV-Tag 3B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Contains only the ROC-COR-Kinase domains aa 1329-2219 | 2026-08-15 01:12:36 | 2 |
|
CBX2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25158 | CBX2_04 | Homo sapiens | Kanamycin | For more information, please see: http://www.thesgc.org/structures/3H91/ http://www.thesgc.org/structures/5EPK/ | Backbone Marker:SGC (Addgene Plasmid # 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:39 | 2 | ||
|
KRASB Resource Report Resource Website 1+ mentions |
RRID:Addgene_25153 | KRASb:M1-K169 | Homo sapiens | Kanamycin | PDB: 3GFT. http://www.thesgc.org/structures/3GFT/ | Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Q61H | 2026-08-15 01:12:37 | 1 | |
|
NEDD4L Resource Report Resource Website 1+ mentions |
RRID:Addgene_25169 | nedd4l.0574.0947 | Homo sapiens | Kanamycin | PDB: 2ONI. http://www.thesgc.org/structures/2ONI/ | Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Hect Domain | 2026-08-15 01:12:38 | 2 | |
|
EPHA3 (2GSF) Resource Report Resource Website 1+ mentions |
RRID:Addgene_25136 | epha3.577.947 | Homo sapiens | Kanamycin | PDB: 2GSF. http://www.thesgc.org/structures/2GSF/ . | Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:37 | 1 | ||
|
USP21 (3I3T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_25147 | usp21.209.563 | Homo sapiens | Kanamycin | PDB: 3I3T. http://www.thesgc.org/structures/3I3T/ | Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:39 | 1 | ||
|
UBC47 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25145 | ubc47.001.193 | Homo sapiens | Kanamycin | PDB: 3BZH. http://www.thesgc.org/structures/3BZH/ | Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC notag; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:37 | 1 | ||
|
pEVOL-pAzF Resource Report Resource Website 50+ mentions |
RRID:Addgene_31186 | M.j. p-azidohenylalanine RS (2 copies +tRNA) | M.jannaschii | Chloramphenicol | PMID:12148987 | Backbone Size:5000; Vector Backbone:p15A; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | Y32T, E107N, D158P, I159L, L162Q, D286R | 2026-08-15 01:13:33 | 52 | |
|
pDEST-HemmarR Resource Report Resource Website 1+ mentions |
RRID:Addgene_31222 | CD4-tdTom | Homo sapiens | Chloramphenicol and Ampicillin | PMID:21606367 | Gateway destination vector for cloning any enhancer to drive expression of membrane marker CD4-tdTom The depositing laboratory recommends growing bacteria either on LB plates with 80 ug/ml Carbenicillin or in LB liquid media with 60 ug/ml Carbenicillin (a semi-synthetic ampicillin analog) | Backbone Size:10193; Vector Backbone:pAPIC-HIH; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | Fusion of signal peptide of Drosophila Akh gene, human CD4 transmembrane domain, tdTomato, and Kir2.1 ER exit signal. | 2026-08-15 01:13:33 | 2 |
|
pKEB31 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31224 | ccdB and Cm resistance gene | Chloramphenicol | PMID:21493687 | Backbone Size:12617; Vector Backbone:pDD62; Vector Types:; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:13:33 | 2 | |||
|
pQCXI Puro DsRed-LC3-GFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_31182 | DsRed-LC3-GFP | Ampicillin | PMID:21575862 | DsRed-LC3-GFP autophagy reporter plasmid. The LC3 gene is from rat. | Backbone Marker:Clontech; Backbone Size:7100; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:32 | 13 | ||
|
pLenti6/V5-DEST-MCM7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31212 | MCM7 | Homo sapiens | Ampicillin | PMID:21741599 | Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:29 | 3 | ||
|
pLenti6/V5-DEST-NCAPH Resource Report Resource Website 1+ mentions |
RRID:Addgene_31214 | NCAPH | Homo sapiens | Ampicillin | PMID:21741599 | Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:33 | 1 | ||
|
pQTEV Resource Report Resource Website 1+ mentions |
RRID:Addgene_31291 | Ampicillin | PMID:14739323 | The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence. | Backbone Marker:Qiagen; Backbone Size:4803; Vector Backbone:pQE-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:34 | 2 | |||
|
pLenti6/V5-DEST-RNF2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31216 | RNF2 | Homo sapiens | Ampicillin | PMID:21741599 | Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:33 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.