Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: pMEND-Lx
Vector Backbone Description: Backbone Size:8798; Vector Backbone:pMINDLx; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20434484
Proper citation: RRID:Addgene_25010 Copy
Genetic Insert: CMV-miR-31 sponge
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA5-CMV-d2eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524507
Comments: miR-31 sponge generated by cloning oligonucleotides containing seven tandem “bulged” (at positions 9-12) miR-31 binding motifs (AGGCAAGACGAGGCATAGCT) into the XhoI and ApaI sites of the CMV sponge backbone.
Proper citation: RRID:Addgene_25025 Copy
Species: Plasmodium falciparum
Genetic Insert: PF11_0301:C22904
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7746; Vector Backbone:p15TV-L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 2PT9. http://www.thesgc.org/structures/2PT9/ .
Proper citation: RRID:Addgene_25110 Copy
Species: Homo sapiens
Genetic Insert: pro-SUMO3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17591783
Proper citation: RRID:Addgene_25103 Copy
Species: Homo sapiens
Genetic Insert: pro-SUMO2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17591783
Proper citation: RRID:Addgene_25102 Copy
Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Cookson Lab; Backbone Size:4300; Vector Backbone:pCMV-Tag 3B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18397888
Comments: An additional Myc tag has been added to the original vector. The 2XMyc vector was adapted to the invitrogen gateway system by insertion of a gateway cloning cassette. LRRK2 was cloned by gateway recombination.
Proper citation: RRID:Addgene_25065 Copy
Species: Homo sapiens
Genetic Insert: CBX2_04
Vector Backbone Description: Backbone Marker:SGC (Addgene Plasmid # 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: For more information, please see:
http://www.thesgc.org/structures/3H91/
http://www.thesgc.org/structures/5EPK/
Proper citation: RRID:Addgene_25158 Copy
Species: Homo sapiens
Genetic Insert: KRASb:M1-K169
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3GFT. http://www.thesgc.org/structures/3GFT/
Proper citation: RRID:Addgene_25153 Copy
Species: Homo sapiens
Genetic Insert: nedd4l.0574.0947
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2ONI. http://www.thesgc.org/structures/2ONI/
Proper citation: RRID:Addgene_25169 Copy
Species: Homo sapiens
Genetic Insert: epha3.577.947
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2GSF. http://www.thesgc.org/structures/2GSF/ .
Proper citation: RRID:Addgene_25136 Copy
Species: Homo sapiens
Genetic Insert: usp21.209.563
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3I3T. http://www.thesgc.org/structures/3I3T/
Proper citation: RRID:Addgene_25147 Copy
Species: Homo sapiens
Genetic Insert: ubc47.001.193
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC notag; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3BZH. http://www.thesgc.org/structures/3BZH/
Proper citation: RRID:Addgene_25145 Copy
Species: M.jannaschii
Genetic Insert: M.j. p-azidohenylalanine RS (2 copies +tRNA)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:p15A; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:12148987
Proper citation: RRID:Addgene_31186 Copy
Species: Homo sapiens
Genetic Insert: CD4-tdTom
Vector Backbone Description: Backbone Size:10193; Vector Backbone:pAPIC-HIH; Vector Types:Insect Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21606367
Comments: Gateway destination vector for cloning any enhancer to drive expression of membrane marker CD4-tdTom
The depositing laboratory recommends growing bacteria either on LB plates with 80 ug/ml Carbenicillin or in LB liquid media with 60 ug/ml Carbenicillin (a semi-synthetic ampicillin analog)
Proper citation: RRID:Addgene_31222 Copy
Genetic Insert: ccdB and Cm resistance gene
Vector Backbone Description: Backbone Size:12617; Vector Backbone:pDD62; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:21493687
Proper citation: RRID:Addgene_31224 Copy
Genetic Insert: DsRed-LC3-GFP
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7100; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21575862
Comments: DsRed-LC3-GFP
autophagy reporter plasmid. The LC3 gene is from rat.
Proper citation: RRID:Addgene_31182 Copy
Species: Homo sapiens
Genetic Insert: MCM7
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21741599
Proper citation: RRID:Addgene_31212 Copy
Species: Homo sapiens
Genetic Insert: NCAPH
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21741599
Proper citation: RRID:Addgene_31214 Copy
Vector Backbone Description: Backbone Marker:Qiagen; Backbone Size:4803; Vector Backbone:pQE-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14739323
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
Proper citation: RRID:Addgene_31291 Copy
Species: Homo sapiens
Genetic Insert: RNF2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21741599
Proper citation: RRID:Addgene_31216 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
