Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: CsChrimson.mVenus
Vector Backbone Description: Backbone Marker:synthetic- Potter Lab; Backbone Size:8335; Vector Backbone:p10QUAS; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35442190
Comments: Read the preprint on bioRxiv: https://www.biorxiv.org/content/10.1101/2020.11.07.355651v2
Also refer to: Klapoetke, N.C., Murata, Y., Kim, S.S., Pulver, S.R., Birdsey-Benson, A., Cho, Y.K., Morimoto, T.K., Chuong, A.S., Carpenter, E.J., Tian, Z., et al. (2014). Independent optical excitation of distinct neural populations. Nat Methods 11, 338-346. PMID: 24509633, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3943671/
Proper citation: RRID:Addgene_163629 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163574 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Dcp2
Vector Backbone Description: Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32553117
Comments: Lacking C-terminal domain.
5' sequencing primers:
Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG
Proper citation: RRID:Addgene_163577 Copy
Species: Other
Genetic Insert: GaLV MTR envelope
Vector Backbone Description: Backbone Marker:Addgene 15802; Backbone Size:4764; Vector Backbone:phCMV-ECO-ENV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31586074
Comments: This plasmid was generated by modification of Addgene plasmid 15802 to excise ENV-Eco and replace with ENV GALV-MTR.
Proper citation: RRID:Addgene_163612 Copy
Species: Homo sapiens
Genetic Insert: BCL2
Vector Backbone Description: Backbone Size:6574; Vector Backbone:MSCV_IRES_huDC2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31586074
Comments: The huCD2 portion of the MSCV_IRES_huDC2 backbone was added by Dr Martin Turner, Babraham Institute, Cambridge by modification of Addgene plasmid # 27490.
Proper citation: RRID:Addgene_163611 Copy
Species: Synthetic
Genetic Insert: DHB:2xmKate2::3xHA
Vector Backbone Description: Backbone Marker:Bob Goldstein/Ari Pani; Backbone Size:11926; Vector Backbone:pAP088; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33350383
Comments: 2xmKate2 fusion of C. elegans codon-optimized DNA Helicase B (DHB) under the rps-27 promoter for ubiquitous expression. Plasmid is for CRISPR/Cas9-mediated single copy insertion at the ttTi4348 site on Chromosome I and can be paired with sgRNA plasmid pAP082
Proper citation: RRID:Addgene_163641 Copy
Species: Homo sapiens
Genetic Insert: mannosidase alpha class 2A member 1
Vector Backbone Description: Backbone Marker:Dr. Lu Lei's lab; Backbone Size:5523; Vector Backbone:pDmyc-neo-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34533190
Proper citation: RRID:Addgene_163648 Copy
Species: Mus musculus
Genetic Insert: Bmp8a
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760
Proper citation: RRID:Addgene_163592 Copy
Species: Mus musculus
Genetic Insert: Gdf2
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760
Proper citation: RRID:Addgene_163595 Copy
Species: Homo sapiens
Genetic Insert: hMECP2-cycle3GFP
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33046553
Proper citation: RRID:Addgene_163706 Copy
Species: Synthetic
Genetic Insert: mirNega and EGFP
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33046553
Proper citation: RRID:Addgene_163705 Copy
Species: Homo sapiens
Genetic Insert: CARD11
Vector Backbone Description: Vector Backbone:PRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33202260
Proper citation: RRID:Addgene_163770 Copy
Species: Homo sapiens
Genetic Insert: TRAF4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12788948
Proper citation: RRID:Addgene_16377 Copy
Species: Mus musculus
Genetic Insert: synaptophysin 9X HA
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33043885
Proper citation: RRID:Addgene_163686 Copy
Species: Synthetic
Genetic Insert: lldr gfp.20TAG
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33290521
Proper citation: RRID:Addgene_163729 Copy
Species: Synthetic
Genetic Insert: araC gfp.2TAG
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33290521
Proper citation: RRID:Addgene_163722 Copy
Species: Synthetic
Genetic Insert: lldr gfp
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33290521
Proper citation: RRID:Addgene_163724 Copy
Species: Synthetic
Genetic Insert: araC gfp.3TAG
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33290521
Proper citation: RRID:Addgene_163723 Copy
Species: Synthetic
Genetic Insert: lldr gfp.2TAG
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33290521
Proper citation: RRID:Addgene_163726 Copy
Species: Homo sapiens
Genetic Insert: NXPH4
Vector Backbone Description: Backbone Marker:Wiederschain et al., 2009 Cell Cycle 8:3, 498-504; Backbone Size:9084; Vector Backbone:pLKO-Tet-On (Tet-pLKO-Neo) Addgene # 21916; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_163744 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.