Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: K-Ras
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21706014
Comments: Do NOT use this plasmid directly for transfections, you will need to recombine it into a destination vector.
A set of 4 custom lentiviral vectors is available (http://www.addgene.org/25895, http://www.addgene.org/25896, http://www.addgene.org/25897, http://www.addgene.org/25890) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_31200 Copy
Vector Backbone Description: Backbone Size:4553; Vector Backbone:pTC-mcs; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:21238944
Proper citation: RRID:Addgene_31288 Copy
Species: Homo sapiens
Genetic Insert: ANLN
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti 6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21741599
Comments: Please note that the ANLN insert in this plasmid is based on GenBank entry BC034692, rather than the full-length transcript (GenBank entry NM_018685.2).
Proper citation: RRID:Addgene_31203 Copy
Species: Homo sapiens
Genetic Insert: HMGB1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21741599
Proper citation: RRID:Addgene_31208 Copy
Species: Homo sapiens
Genetic Insert: TopBP1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5-FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21502314
Proper citation: RRID:Addgene_31313 Copy
Genetic Insert: ECFP(loxP)EYFP
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12682379
Comments: Cre reporter: from blue fluorescence to yellow fluorescence
Proper citation: RRID:Addgene_31306 Copy
Species: Homo sapiens
Genetic Insert: Mesothelin
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21505261
Comments: Msln Promoter sequence provided by author (see above link)
Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid.
Msln-1F: TCATTTGTTCCCTTTGACGGC
Msln-1R: CTCTCCCCAGCATCCACATTC
Expect 987 nt product
Msln-2F: TTGCCTACAACACCCTGCTGCG
Msln-2R: GCTCACAATGCTTCCATCAAACG
Expect 792 nt product
Proper citation: RRID:Addgene_31305 Copy
Species: Homo sapiens
Genetic Insert: Human Homologue of Ariadne (HHARI)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX-4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21532592
Comments: Capili AD, Edghill EL, Wu, K and Borden KL (2004)Structure of the C-terminal RING Finger from a RING-IBR-RING/TRIAD Motif Reveals a Novel Zinc-binding Domain Distinct from a RING. J. Mol. Bio. 340:1117-29.
Proper citation: RRID:Addgene_31254 Copy
Species: Homo sapiens
Genetic Insert: Huntingtin-interacting protein 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12163454
Proper citation: RRID:Addgene_31253 Copy
Species: Homo sapiens
Genetic Insert: Brd4 444-722
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454
Proper citation: RRID:Addgene_31353 Copy
Species: Homo sapiens
Genetic Insert: Brd4 1224-1362
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454
Proper citation: RRID:Addgene_31355 Copy
Species: Homo sapiens
Genetic Insert: Brd4 1047-1362
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454
Proper citation: RRID:Addgene_31354 Copy
Species: Homo sapiens
Genetic Insert: JMJD6
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555454
Proper citation: RRID:Addgene_31358 Copy
Species: Homo sapiens
Genetic Insert: protein phosphatase 1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15998469
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31331 Copy
Species: Homo sapiens
Genetic Insert: PSMD10, proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 (gankyrin)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15998469
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31332 Copy
Species: Homo sapiens
Genetic Insert: PRDX2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15998469
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31338 Copy
Species: Homo sapiens
Genetic Insert: HNF4A 3'UTR (long)
Vector Backbone Description: Backbone Size:6380; Vector Backbone:pRL-Con; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22140441
Comments: To measure regulatory potential of 3'UTR
Please note that there are some small discrepancies between Addgene's quality control sequence and the assembled sequence from the depositor. These discrepancies should not affect the function of the plasmid.
Proper citation: RRID:Addgene_31445 Copy
Species: Homo sapiens
Genetic Insert: stathmin 1/oncoprotein 18
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15998469
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Please note that Addgene's quality control sequence shows a small deletion in the vector region downstream of insert; the deletion does not affect any features in this construct.
Proper citation: RRID:Addgene_31326 Copy
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3501; Vector Backbone:phrGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19105832
Proper citation: RRID:Addgene_31385 Copy
Genetic Insert: rtTA-IRES-BirA
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20890903
Proper citation: RRID:Addgene_31375 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.