Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDONR223-K-RAS V12 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31200 | K-Ras | Homo sapiens | Spectinomycin | PMID:21706014 | Do NOT use this plasmid directly for transfections, you will need to recombine it into a destination vector. A set of 4 custom lentiviral vectors is available (http://www.addgene.org/25895, http://www.addgene.org/25896, http://www.addgene.org/25897, http://www.addgene.org/25890) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately. | Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin | G12V constitutively active | 2026-08-15 01:13:29 | 3 |
|
pTCS-mcs Resource Report Resource Website 1+ mentions |
RRID:Addgene_31288 | Streptomycin | PMID:21238944 | Backbone Size:4553; Vector Backbone:pTC-mcs; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:13:34 | 1 | ||||
|
pLenti6/V5-DEST-ANLN Resource Report Resource Website 1+ mentions |
RRID:Addgene_31203 | ANLN | Homo sapiens | Ampicillin | PMID:21741599 | Please note that the ANLN insert in this plasmid is based on GenBank entry BC034692, rather than the full-length transcript (GenBank entry NM_018685.2). | Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti 6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:29 | 1 | |
|
pLenti6/V5-DEST-HMGB1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31208 | HMGB1 | Homo sapiens | Ampicillin | PMID:21741599 | Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:33 | 1 | ||
|
pcDNA5-FRT/TO-LacR-TopBP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31313 | TopBP1 | Homo sapiens | Ampicillin | PMID:21502314 | Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5-FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:31 | 1 | ||
|
LCMV:ECFP(loxP)EYFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_31306 | ECFP(loxP)EYFP | Ampicillin | PMID:12682379 | Cre reporter: from blue fluorescence to yellow fluorescence | Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:34 | 1 | ||
|
pAdEasy-Msln-iCre-HA-Flag Resource Report Resource Website 1+ mentions |
RRID:Addgene_31305 | Mesothelin | Homo sapiens | Kanamycin | PMID:21505261 | Msln Promoter sequence provided by author (see above link) Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid. Msln-1F: TCATTTGTTCCCTTTGACGGC Msln-1R: CTCTCCCCAGCATCCACATTC Expect 987 nt product Msln-2F: TTGCCTACAACACCCTGCTGCG Msln-2R: GCTCACAATGCTTCCATCAAACG Expect 792 nt product | Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Adenoviral; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:30 | 2 | |
|
pGEX-4T HHARI RBR Resource Report Resource Website 1+ mentions |
RRID:Addgene_31254 | Human Homologue of Ariadne (HHARI) | Homo sapiens | Ampicillin | PMID:21532592 | Capili AD, Edghill EL, Wu, K and Borden KL (2004)Structure of the C-terminal RING Finger from a RING-IBR-RING/TRIAD Motif Reveals a Novel Zinc-binding Domain Distinct from a RING. J. Mol. Bio. 340:1117-29. | Backbone Size:5000; Vector Backbone:pGEX-4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | RBR domain residues 177-395 | 2026-08-15 01:13:33 | 1 |
|
pcDNA3/HIP1/ΔLD Resource Report Resource Website 1+ mentions |
RRID:Addgene_31253 | Huntingtin-interacting protein 1 | Homo sapiens | Ampicillin | PMID:12163454 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Deltion of nucleotides 767-1335 | 2026-08-15 01:13:33 | 1 | |
|
p6347 MSCV-CMV-Flag-HA-Brd4-444-722 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31353 | Brd4 444-722 | Homo sapiens | Ampicillin | PMID:21555454 | Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:34 | 1 | ||
|
p6349 MSCV-CMV-Flag-HA-Brd4 1224-1362 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31355 | Brd4 1224-1362 | Homo sapiens | Ampicillin | PMID:21555454 | Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:35 | 2 | ||
|
p6348 MSCV-CMV-Flag-HA-Brd4 1047-1362 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31354 | Brd4 1047-1362 | Homo sapiens | Ampicillin | PMID:21555454 | Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:31 | 1 | ||
|
p6352 MSCV-CMV-CMV-Flag-HA-JMJD6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31358 | JMJD6 | Homo sapiens | Ampicillin | PMID:21555454 | Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:35 | 8 | ||
|
pQTEV-PPP1R1A Resource Report Resource Website 1+ mentions |
RRID:Addgene_31331 | protein phosphatase 1 | Homo sapiens | Ampicillin | PMID:15998469 | The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence. The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence. | Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:31 | 1 | |
|
pQTEV-PSMD10 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31332 | PSMD10, proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 (gankyrin) | Homo sapiens | Ampicillin | PMID:15998469 | The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence. The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence. | Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:34 | 1 | |
|
pQTEV- PRDX2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31338 | PRDX2 | Homo sapiens | Ampicillin | PMID:15998469 | The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence. The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence. | Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:31 | 4 | |
|
pRLCon1-3180 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31445 | HNF4A 3'UTR (long) | Homo sapiens | Ampicillin | PMID:22140441 | To measure regulatory potential of 3'UTR Please note that there are some small discrepancies between Addgene's quality control sequence and the assembled sequence from the depositor. These discrepancies should not affect the function of the plasmid. | Backbone Size:6380; Vector Backbone:pRL-Con; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:32 | 1 | |
|
pQTEV-STMN1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31326 | stathmin 1/oncoprotein 18 | Homo sapiens | Ampicillin | PMID:15998469 | The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence. The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence. Please note that Addgene's quality control sequence shows a small deletion in the vector region downstream of insert; the deletion does not affect any features in this construct. | Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:34 | 2 | |
|
pT-FLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_31385 | Ampicillin | PMID:19105832 | Backbone Marker:Stratagene; Backbone Size:3501; Vector Backbone:phrGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:31 | 2 | ||||
|
pAd:CMV-rtTA-IRES-birA Resource Report Resource Website 1+ mentions |
RRID:Addgene_31375 | rtTA-IRES-BirA | Kanamycin | PMID:20890903 | Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:35 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
