Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: YWHAG
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pTvHR21-SGC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2B05/
Proper citation: RRID:Addgene_39129 Copy
Species: Homo sapiens
Genetic Insert: GUCY1A3
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNH-TrxT; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3UVJ/
Proper citation: RRID:Addgene_39120 Copy
Species: Homo sapiens
Genetic Insert: GUCY1B3
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC-CTHF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3UVJ/
Proper citation: RRID:Addgene_39121 Copy
Species: Homo sapiens
Genetic Insert: TAF1
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3UV4/
Proper citation: RRID:Addgene_39117 Copy
Species: Homo sapiens
Genetic Insert: AURKB
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4AF3/
Proper citation: RRID:Addgene_39119 Copy
Species: Homo sapiens
Genetic Insert: TAF1
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3UV5/
Proper citation: RRID:Addgene_39118 Copy
Species: Homo sapiens
Genetic Insert: JMJD5
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4AAP/
Proper citation: RRID:Addgene_39113 Copy
Species: Homo sapiens
Genetic Insert: LACTB2
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4AD9/
Proper citation: RRID:Addgene_39115 Copy
Species: Homo sapiens
Genetic Insert: BPTF
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3UV2/
Proper citation: RRID:Addgene_39111 Copy
Species: Homo sapiens
Genetic Insert: ELAC1
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC-CTHF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3ZWF/
Proper citation: RRID:Addgene_39110 Copy
Species: Homo sapiens
Genetic Insert: CDKL1
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC-CTHF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4AGU/
Proper citation: RRID:Addgene_39109 Copy
Genetic Insert: none
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-Sec-NH; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_39189 Copy
Species: Homo sapiens
Genetic Insert: INCENP
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pGTvL1-SGC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/3U23/
Proper citation: RRID:Addgene_39185 Copy
Species: Homo sapiens
Genetic Insert: p34
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_39221 Copy
Genetic Insert: p44
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_39220 Copy
Species: Homo sapiens
Genetic Insert: AASDHPPT
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pCOEX-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: http://www.thesgc.org/structures/2BYD/
Proper citation: RRID:Addgene_39192 Copy
Genetic Insert: none
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-CT10HF-LIC; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Comments: Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: GATTGGAAGTAGAGGTTCTCTGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector.
Proper citation: RRID:Addgene_39191 Copy
Species: Homo sapiens
Genetic Insert: p52
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_39219 Copy
Species: Homo sapiens
Genetic Insert: XPG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6646; Vector Backbone:pMAL-c2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7657672
Proper citation: RRID:Addgene_39215 Copy
Species: Homo sapiens
Genetic Insert: ABL2
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-LIC-Bse; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/3GVU/
Proper citation: RRID:Addgene_39178 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.