Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 319 showing 6361 ~ 6380 out of 740,326 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_39129

    This resource has 1+ mentions.

http://www.addgene.org/39129

Species: Homo sapiens
Genetic Insert: YWHAG
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pTvHR21-SGC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/2B05/

Proper citation: RRID:Addgene_39129 Copy   


  • RRID:Addgene_39120

http://www.addgene.org/39120

Species: Homo sapiens
Genetic Insert: GUCY1A3
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNH-TrxT; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3UVJ/

Proper citation: RRID:Addgene_39120 Copy   


  • RRID:Addgene_39121

http://www.addgene.org/39121

Species: Homo sapiens
Genetic Insert: GUCY1B3
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC-CTHF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3UVJ/

Proper citation: RRID:Addgene_39121 Copy   


  • RRID:Addgene_39117

    This resource has 1+ mentions.

http://www.addgene.org/39117

Species: Homo sapiens
Genetic Insert: TAF1
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3UV4/

Proper citation: RRID:Addgene_39117 Copy   


  • RRID:Addgene_39119

    This resource has 1+ mentions.

http://www.addgene.org/39119

Species: Homo sapiens
Genetic Insert: AURKB
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4AF3/

Proper citation: RRID:Addgene_39119 Copy   


  • RRID:Addgene_39118

    This resource has 1+ mentions.

http://www.addgene.org/39118

Species: Homo sapiens
Genetic Insert: TAF1
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3UV5/

Proper citation: RRID:Addgene_39118 Copy   


  • RRID:Addgene_39113

http://www.addgene.org/39113

Species: Homo sapiens
Genetic Insert: JMJD5
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4AAP/

Proper citation: RRID:Addgene_39113 Copy   


  • RRID:Addgene_39115

http://www.addgene.org/39115

Species: Homo sapiens
Genetic Insert: LACTB2
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4AD9/

Proper citation: RRID:Addgene_39115 Copy   


  • RRID:Addgene_39111

    This resource has 1+ mentions.

http://www.addgene.org/39111

Species: Homo sapiens
Genetic Insert: BPTF
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3UV2/

Proper citation: RRID:Addgene_39111 Copy   


  • RRID:Addgene_39110

http://www.addgene.org/39110

Species: Homo sapiens
Genetic Insert: ELAC1
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC-CTHF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3ZWF/

Proper citation: RRID:Addgene_39110 Copy   


  • RRID:Addgene_39109

http://www.addgene.org/39109

Species: Homo sapiens
Genetic Insert: CDKL1
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC-CTHF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/4AGU/

Proper citation: RRID:Addgene_39109 Copy   


  • RRID:Addgene_39189

    This resource has 1+ mentions.

http://www.addgene.org/39189

Genetic Insert: none
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-Sec-NH; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_39189 Copy   


  • RRID:Addgene_39185

http://www.addgene.org/39185

Species: Homo sapiens
Genetic Insert: INCENP
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pGTvL1-SGC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/3U23/

Proper citation: RRID:Addgene_39185 Copy   


  • RRID:Addgene_39221

http://www.addgene.org/39221

Species: Homo sapiens
Genetic Insert: p34
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_39221 Copy   


  • RRID:Addgene_39220

http://www.addgene.org/39220

Genetic Insert: p44
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_39220 Copy   


  • RRID:Addgene_39192

http://www.addgene.org/39192

Species: Homo sapiens
Genetic Insert: AASDHPPT
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pCOEX-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Comments: http://www.thesgc.org/structures/2BYD/

Proper citation: RRID:Addgene_39192 Copy   


  • RRID:Addgene_39191

    This resource has 1+ mentions.

http://www.addgene.org/39191

Genetic Insert: none
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-CT10HF-LIC; Vector Types:Baculovirus; Bacterial Resistance:Ampicillin
Comments: Primers for LIC cloning: Add the following 5’ extensions to the PCR primers: Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon) Downstream: GATTGGAAGTAGAGGTTCTCTGC The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector.

Proper citation: RRID:Addgene_39191 Copy   


  • RRID:Addgene_39219

http://www.addgene.org/39219

Species: Homo sapiens
Genetic Insert: p52
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7125; Vector Backbone:p2Bac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_39219 Copy   


  • RRID:Addgene_39215

http://www.addgene.org/39215

Species: Homo sapiens
Genetic Insert: XPG
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6646; Vector Backbone:pMAL-c2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7657672

Proper citation: RRID:Addgene_39215 Copy   


  • RRID:Addgene_39178

http://www.addgene.org/39178

Species: Homo sapiens
Genetic Insert: ABL2
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pFB-LIC-Bse; Vector Types:Baculovirus Expression; Bacterial Resistance:Ampicillin
Comments: http://www.thesgc.org/structures/3GVU/

Proper citation: RRID:Addgene_39178 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X