Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: LAR-GECO1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25164254
Comments: The construct is numbered based on GCaMP.
Proper citation: RRID:Addgene_61244 Copy
Species: Synthetic
Genetic Insert: 2xTY1-V5
Vector Backbone Description: Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25324299
Proper citation: RRID:Addgene_61257 Copy
Species: Synthetic
Genetic Insert: 2xTY1-V5
Vector Backbone Description: Backbone Marker:Hugo J Bellen; Backbone Size:3300; Vector Backbone:pBS-KS-attB1-2-PT-SA-SD; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25324299
Proper citation: RRID:Addgene_61256 Copy
Species: Synthetic
Genetic Insert: sgRNA(F+E)
Vector Backbone Description: Backbone Marker:Goldstein lab; Backbone Size:8113; Vector Backbone:pDD162; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25491644
Comments: target sequence: ggatggatgtgtagtcaatt
Proper citation: RRID:Addgene_61250 Copy
Species: Synthetic
Genetic Insert: GAL4_DBD::QF2w_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_61309 Copy
Species: Synthetic
Genetic Insert: QF2w
Vector Backbone Description: Vector Backbone:pGAWB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_61313 Copy
Species: Synthetic
Genetic Insert: LexA_DBD::QF2w_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_61311 Copy
Species: Synthetic
Genetic Insert: LexA_DBD::QF2_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_61310 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.
Proper citation: RRID:Addgene_61347 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.
Proper citation: RRID:Addgene_61346 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.
Proper citation: RRID:Addgene_61345 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.
Proper citation: RRID:Addgene_61344 Copy
Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.
Proper citation: RRID:Addgene_61342 Copy
Species: Synthetic
Genetic Insert: S.pyogenes dCas9 with c-terminal HA tag
Vector Backbone Description: Backbone Marker:Invitrogen; Life Technologies; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25849900
Proper citation: RRID:Addgene_61355 Copy
Species: Synthetic
Genetic Insert: dCAS9(D10A, N863A)-VP64_2A_Blast
Vector Backbone Description: Vector Backbone:plenti; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25494202
Comments: IMPORTANT NOTE: If you intend to order the SAM library, this plasmid will come included with that order. Please do NOT order this plasmid if you are already planning to order the SAM library.
For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/
Proper citation: RRID:Addgene_61425 Copy
Species: Synthetic
Genetic Insert: Cer.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360
Proper citation: RRID:Addgene_61389 Copy
Species: Synthetic
Genetic Insert: tol1.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360
Proper citation: RRID:Addgene_61388 Copy
Species: Synthetic
Genetic Insert: dCAS9(D10A,H840A)-VP64_2A_GFP
Vector Backbone Description: Vector Backbone:lenti(AMP); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25494202
Comments: For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/
Proper citation: RRID:Addgene_61422 Copy
Species: Synthetic
Genetic Insert: TagRFPT.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360
Proper citation: RRID:Addgene_61390 Copy
Species: Synthetic
Genetic Insert: Gal4ff.zf1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25628360
Proper citation: RRID:Addgene_61392 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.