Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDEST-Spe4-RfA-mNeonGreen-stop Resource Report Resource Website |
RRID:Addgene_186392 | Chloramphenicol and Ampicillin | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mNeonGreen tag at EcoR V/Avr II restriction site | Backbone Size:5574; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:54 | 0 | ||||
|
pDEST-Spe4-RfA-mEos4b-stop Resource Report Resource Website |
RRID:Addgene_186390 | Chloramphenicol and Ampicillin | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mEos4b tag at EcoR V/Avr II restriction site | Backbone Size:5547; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:53 | 0 | ||||
|
pDEST-pSP172BSSPE-pFOGc::RfA Resource Report Resource Website |
RRID:Addgene_186397 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for electroporation experiments. Backbone was modified by insertion of tag at SwaI restriction site | Backbone Marker:PMID: 17878951; Backbone Size:4650; Vector Backbone:pDEST-pSP172BSSPE-Swa1::RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:54 | 0 | |||
|
pDEST-pSP172BSSPE-Swa1::RfA Resource Report Resource Website |
RRID:Addgene_186396 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for electroporation experiments. The electroporation vector pSP72-1.27 was modified to give rise to pSP72BSSPE by replacing the NLS-LacZ reporter gene, cloned between BamH1 and EcoR1 by a BamH1-Swa1-Stu1-Pme1-EcoRV-EcoR1 polylinker (GGATCCATTTAAATAGGCCTTTGTTTAAACTTAGATATCGGAATTC). | Backbone Marker:PMID: 9043074; Backbone Size:4650; Vector Backbone:Ascidian electroporation vector pSP72-1.27; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:54 | 0 | |||
|
pDEST-Spe4-RfA-Snaptag-stop Resource Report Resource Website |
RRID:Addgene_186395 | Chloramphenicol and Ampicillin | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal Snap-tag tag at EcoR V/Avr II restriction site | Backbone Size:5412; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:56 | 0 | ||||
|
pDEST-pSP172BSSPE-Swa1::RfA-ECFP Resource Report Resource Website |
RRID:Addgene_186402 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for electroporation experiments. Backbone was modified by insertion of C terminal ECFP tag at EcoR V restriction site | Backbone Marker:PMID: 17878951; Backbone Size:5370; Vector Backbone:pDEST-pSP172BSSPE-Swa1::RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:57 | 0 | |||
|
pDEST-pSP172BSSPE-pFOGc::venus-RfA Resource Report Resource Website |
RRID:Addgene_186400 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for electroporation experiments. Backbone was modified by insertion of N terminal Venus tag at SwaI restriction site | Backbone Marker:PMID: 17878951; Backbone Size:5385; Vector Backbone:pDEST-pSP172BSSPE-Swa1::venus-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:54 | 0 | |||
|
PDEST-pSP172BSSPE-pFOGc::RfA-ECFP Resource Report Resource Website |
RRID:Addgene_186403 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for electroporation experiments. Erroneously annotated in the article PMID 17878951 as pSP72BSSPE-pFOG::RfA-CFP | Backbone Marker:PMID: 17878951; Vector Backbone:pDEST-pSP172BSSPE-Swa1::RfA-ECFP; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:54 | 0 | |||
|
pDEST-Spe4-Kozak-mCherry-RfA Resource Report Resource Website |
RRID:Addgene_186378 | Chloramphenicol and Ampicillin | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mCherry tag at Bgl II/Stu I restriction site | Backbone Size:5589; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:56 | 0 | ||||
|
pDEST-Spe4-RfA Resource Report Resource Website |
RRID:Addgene_186375 | Chloramphenicol and Ampicillin | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. This plasmid was obtained by gene synthesis from pDEST-Spe3-RfA by addition of a BglII-ZraI-AatII-StuI-SnaBI (agatctgacgtcaggccttacgta) polylinker before the attR1 sequence and an EcoRV-SacII-AfeI-BstEII-AvrII (gatatcgcggccgcggaagcgctggttacctagg) polylinker after the attR2 sequence. | Backbone Marker:PMID: 17878951; Backbone Size:4888; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:53 | 0 | ||||
|
pDEST-Spe3-RfA-HA Resource Report Resource Website |
RRID:Addgene_186374 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal HA tag at EcoR V restriction site | Backbone Marker:PMID: 17878951; Backbone Size:4915; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:53 | 0 | |||
|
pDEST-Spe3-HA-RfA Resource Report Resource Website |
RRID:Addgene_186373 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal HA tag at Stu I restriction site | Backbone Marker:PMID: 17878951; Backbone Size:4926; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:56 | 0 | |||
|
pINDUCER20_mGFP Resource Report Resource Website |
RRID:Addgene_190027 | Chloramphenicol and Ampicillin | C terminal mEGFP on backbone | Backbone Marker:Stephen Elledge (Addgene #44012); Backbone Size:12546; Vector Backbone:pINDUCER20; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:24:20 | 0 | ||||
|
MSCV-pU6-(BbsI)-CcdB-(BbsI)-Pgk-Puro-T2A-BFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_86457 | BFP | Other | Chloramphenicol and Ampicillin | PMID:27729526 | Backbone Size:3125; Vector Backbone:pBS; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:16 | 7 | ||
|
pDEST-pSP172BSSPE-R3-ccdB/CmR-R4-bpFOG-B5::B1-NLSLacZ-B2 Resource Report Resource Website |
RRID:Addgene_186414 | lacZ | E. coli | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for electroporation experiments. | Backbone Marker:PMID: 17878951; Backbone Size:8537; Vector Backbone:pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:31 | 0 | |
|
pGP4G-REL2N91-ccdB Resource Report Resource Website |
RRID:Addgene_188444 | REL2N91/ccdB | Synthetic | Chloramphenicol and Ampicillin | PMID:32123041 | Vector Backbone:pGP4G; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:38 | 0 | ||
|
pDEST tol2 UbB polyA Resource Report Resource Website 1+ mentions |
RRID:Addgene_188701 | Chloramphenicol and Ampicillin | PMID:26445458 | Vector Backbone:pDEST tol2; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:39 | 1 | ||||
|
pMLS715 Resource Report Resource Website |
RRID:Addgene_188887 | Chloramphenicol and Ampicillin | PMID:34748534 | Vector Backbone:pDEST-P4-P3; Vector Types:Multisite Gateway [4-3] Destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:23:39 | 0 | ||||
|
pFUSE-DEST_R1R4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_97186 | Chloramphenicol and Ampicillin | PMID:28512244 | Recombine Gene A + Gene B into this Destination vector by Gateway LR reaction to make the final fusion. The pFUSE-A_P1P2 is the same plasmid as Gateway™ pDONR™221 Vector and is commercially available from ThermoFisher Scientific (Cat#: 12536017). | Backbone Size:10044; Vector Backbone:pFUSE-DEST_R1R4; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:22:34 | 1 | |||
|
pNOC-RLUC Resource Report Resource Website 1+ mentions |
RRID:Addgene_98142 | Chloramphenicol and Ampicillin | PMID:30883973 | Backbone Size:9185; Vector Backbone:pNOC-Flux; Vector Types:Algae, Nannochloropsis; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:22:35 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.