Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pEN_TTmiRc2 3XFLAG-MKK7-EE-NLS Resource Report Resource Website |
RRID:Addgene_87777 | MKK7-EE | Gentamicin | PMID:28174228 | Backbone Marker:Addgene #83274; Backbone Size:4496; Vector Backbone:pEN_TTmiRc2 3xFLAG; Vector Types:; Bacterial Resistance:Gentamicin | 2026-08-15 01:21:48 | 0 | |||
|
pEN_TTmiRc2 3XFLAG-MKK4-EE-NLS Resource Report Resource Website |
RRID:Addgene_87776 | MKK4 | Homo sapiens | Gentamicin | PMID:28174228 | Backbone Marker:Addgene #83274; Backbone Size:4496; Vector Backbone:pEN_TTmiRc2 3xFLAG; Vector Types:; Bacterial Resistance:Gentamicin | 2026-08-15 01:21:48 | 0 | ||
|
pEN_TT 3xFLAG SMAD4 Resource Report Resource Website |
RRID:Addgene_83094 | SMAD4 | Homo sapiens | Gentamicin | PMID:29161592 | Gateway entry vector for expression of 3xFLAG SMAD4 | Backbone Marker:Addgene #83274; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:21:02 | 0 | |
|
pFastBac1-OSF-TRIM5alpha(chimpanzee) Resource Report Resource Website |
RRID:Addgene_79032 | OSF-TRIM5alpha(chimpanzee) | Pan troglodytes | Gentamicin | PMID:27253068 | Backbone Marker:Life Technologies; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2026-08-15 01:20:28 | 0 | ||
|
pFastBac1-OSF-TRIM5alpha(rhesus) Resource Report Resource Website |
RRID:Addgene_79033 | OSF-TRIM5alpha(rhesus) | Macaca mulatta | Gentamicin | PMID:27253068 | Backbone Marker:Life Technologies; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | 2026-08-15 01:20:28 | 0 | ||
|
pFastBac1-OSF-TRIMCyp (owl monkey)(K283D, Q287D) Resource Report Resource Website |
RRID:Addgene_79036 | OSF-TRIM5Cyp (owl monkey) (K283D, Q287D) | Aotus trivirgatus | Gentamicin | PMID:27253068 | Backbone Marker:Life Technologies; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin | Changed Lys 283 to Asp and Gln 287 to Asp | 2026-08-15 01:20:28 | 0 | |
|
RP4-8 Resource Report Resource Website |
RRID:Addgene_79813 | Gentamicin resistance gene | Pseudomonas - from plasmid pPH1JI | Gentamicin | PMID:15212888 | Depositor states that users can select for the chromosome with nalidixic acid. Depositor states that growth on the respective antibiotic is sufficient to confirm plasmid integrity | Backbone Marker:Natural; Backbone Size:60000; Vector Backbone:RP4; Vector Types:Helper BHR plasmid for mobilizing other plasmids carrying oriT; Bacterial Resistance:Gentamicin | 2026-08-15 01:20:33 | 0 | |
|
pX33 Resource Report Resource Website |
RRID:Addgene_89632 | xylE | Gentamicin | PMID:17074913 | SacB is used for counter-selecton in Mycobacteria to force excision and loss of this plasmid to occur. This plasmid has been used as an allelic exchange vector. We have used SpeI site for cloning of an insert (flanking regions of a target gene to be deleted), so other groups can also use SpeI (NotI and XbaI can be used as well). | Backbone Marker:PMID: 9380741; Backbone Size:8550; Vector Backbone:pPR23; Vector Types:Allelic change mutagenesis; Bacterial Resistance:Gentamicin | 2026-08-15 01:21:59 | 0 | ||
|
pEN_TmiRc3_shURB5 Resource Report Resource Website |
RRID:Addgene_81066 | shRNA targeting UBR5 | Synthetic | Gentamicin | PMID:29742019 | For use with pSLIK lentiviral system. Original publication: A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103 shRNA sequence obtained from the RNAi Codex: A. Olson, N. Sheth, J. S. Lee, G. Hannon and R. Sachidanandam (2005) RNAi Codex: a portal/database for short-hairpin RNA (shRNA) gene-silencing constructs. Nucleic Acids Research, 34, D153-D157 | Backbone Marker:ATCC 10326362 ; Backbone Size:4232; Vector Backbone:pEN_TmiRc3 (pENTR1A-Gent); Vector Types:Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:20:43 | 0 | |
|
pUCP30T-mKo1 Resource Report Resource Website |
RRID:Addgene_78477 | mKO1 | Fungia coccina | Gentamicin | PMID:26937640 | Vector Backbone:pUCP30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin | 2026-08-15 01:20:24 | 0 | ||
|
pUCP30T-eCFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_78476 | eCFP | Aequorea victoria | Gentamicin | PMID:26937640 | Please note that Addgene identified the presence of an eCFP fluorophore rather than the stated eYFP. | Vector Backbone:pUCP30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin | 2026-08-15 01:20:24 | 1 | |
|
pJQ200SK Resource Report Resource Website 1+ mentions |
RRID:Addgene_78497 | Gentamicin | PMID:8486283 | This is the most popular version of the pJQ200 series of vectors. The partial lacZ alpha gene does give blue/white selection, but colonies are only pale blue after 24 hours. Blue colour is clear after 36 hrs. or by using higher x-gal concentration. | Backbone Size:4922; Vector Backbone:pJQ200; Vector Types:Suicide plasmid; Bacterial Resistance:Gentamicin | 2026-08-15 01:20:24 | 2 | |||
|
pJQ200 Resource Report Resource Website |
RRID:Addgene_78496 | Gentamicin | PMID:8486283 | Base vector for suicide vectors pJQ200SK, pJQ200KS, pJQ200mp18, pJQ200mp19 which have been quite widely used for allelic replacement in rhizobia and other bacteria. sacB gene provides basis for selection of double recombinants. | Backbone Size:6500; Vector Backbone:P15A origin vector pACYC184Gm; Vector Types:Suicide vector; Bacterial Resistance:Gentamicin | 2026-08-15 01:20:24 | 0 | |||
|
pJQ210SK Resource Report Resource Website |
RRID:Addgene_78499 | Gentamicin | PMID:8486283 | Cosmid version of suicide vector for gene replacement. Same as pJQ200SK except for addition of cos site. | Backbone Marker:Jurgen Quandt; Backbone Size:4700; Vector Backbone:pJQ200; Vector Types:suicide vector; Bacterial Resistance:Gentamicin | 2026-08-15 01:20:24 | 0 | |||
|
pDON207 NSP3 A890D Resource Report Resource Website |
RRID:Addgene_180069 | SARS-CoV-2 NSP3 A890D | SARS-CoV-2 | Gentamicin | PMID:34709727 | Vector Backbone:pDON207; Vector Types:Mammalian Expression; Bacterial Resistance:Gentamicin | NSP3 A890D | 2026-08-15 01:11:24 | 0 | |
|
pJAT13 Resource Report Resource Website |
RRID:Addgene_18986 | promoter CP13 | Lactococcus lactis | Gentamicin | PMID:11739756 | Backbone Size:0; Vector Backbone:pJN105; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin | 2026-08-15 01:11:41 | 0 | ||
|
pJAT13araE Resource Report Resource Website |
RRID:Addgene_18987 | araE | E.coli | Gentamicin | PMID:11739756 | Backbone Size:0; Vector Backbone:pJAT13; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin | 2026-08-15 01:11:41 | 0 | ||
|
pEN_hU6miR-Luc-A Resource Report Resource Website |
RRID:Addgene_25756 | Luciferase miR-shRNA | Gentamicin | PMID:16945906 | Entry vector with U6-driven Luciferase miR-shRNA Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCCACAGATGTATTAATCAGAGACTTCAGGCGGT | Backbone Marker:ATCC 10326362; Backbone Size:4316; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:12:47 | 0 | ||
|
pEN_hU6miR-G13-L Resource Report Resource Website |
RRID:Addgene_25758 | G alpha 13 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with U6-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT | Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:12:45 | 0 | |
|
pEN_TTRmiRc2 Resource Report Resource Website |
RRID:Addgene_25754 | Gentamicin | PMID:16945906 | shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT | Backbone Marker:ATCC 10326362; Backbone Size:5180; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:12:45 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
