Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: MKK7-EE
Vector Backbone Description: Backbone Marker:Addgene #83274; Backbone Size:4496; Vector Backbone:pEN_TTmiRc2 3xFLAG; Vector Types:; Bacterial Resistance:Gentamicin
Defining Citation: PMID:28174228
Proper citation: RRID:Addgene_87777 Copy
Species: Homo sapiens
Genetic Insert: MKK4
Vector Backbone Description: Backbone Marker:Addgene #83274; Backbone Size:4496; Vector Backbone:pEN_TTmiRc2 3xFLAG; Vector Types:; Bacterial Resistance:Gentamicin
Defining Citation: PMID:28174228
Proper citation: RRID:Addgene_87776 Copy
Species: Homo sapiens
Genetic Insert: SMAD4
Vector Backbone Description: Backbone Marker:Addgene #83274; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29161592
Comments: Gateway entry vector for expression of 3xFLAG SMAD4
Proper citation: RRID:Addgene_83094 Copy
Species: Pan troglodytes
Genetic Insert: OSF-TRIM5alpha(chimpanzee)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27253068
Proper citation: RRID:Addgene_79032 Copy
Species: Macaca mulatta
Genetic Insert: OSF-TRIM5alpha(rhesus)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27253068
Proper citation: RRID:Addgene_79033 Copy
Species: Aotus trivirgatus
Genetic Insert: OSF-TRIM5Cyp (owl monkey) (K283D, Q287D)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27253068
Proper citation: RRID:Addgene_79036 Copy
Species: Pseudomonas - from plasmid pPH1JI
Genetic Insert: Gentamicin resistance gene
Vector Backbone Description: Backbone Marker:Natural; Backbone Size:60000; Vector Backbone:RP4; Vector Types:Helper BHR plasmid for mobilizing other plasmids carrying oriT; Bacterial Resistance:Gentamicin
Defining Citation: PMID:15212888
Comments: Depositor states that users can select for the chromosome with nalidixic acid.
Depositor states that growth on the respective antibiotic is sufficient to confirm plasmid integrity
Proper citation: RRID:Addgene_79813 Copy
Genetic Insert: xylE
Vector Backbone Description: Backbone Marker:PMID: 9380741; Backbone Size:8550; Vector Backbone:pPR23; Vector Types:Allelic change mutagenesis; Bacterial Resistance:Gentamicin
Defining Citation: PMID:17074913
Comments: SacB is used for counter-selecton in Mycobacteria to force excision and loss of this plasmid to occur.
This plasmid has been used as an allelic exchange vector. We have used SpeI site for cloning of an insert (flanking regions of a target gene to be deleted), so other groups can also use SpeI (NotI and XbaI can be used as well).
Proper citation: RRID:Addgene_89632 Copy
Species: Synthetic
Genetic Insert: shRNA targeting UBR5
Vector Backbone Description: Backbone Marker:ATCC 10326362 ; Backbone Size:4232; Vector Backbone:pEN_TmiRc3 (pENTR1A-Gent); Vector Types:Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29742019
Comments: For use with pSLIK lentiviral system. Original publication:
A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103
shRNA sequence obtained from the RNAi Codex:
A. Olson, N. Sheth, J. S. Lee, G. Hannon and R. Sachidanandam (2005) RNAi Codex: a portal/database for short-hairpin RNA (shRNA) gene-silencing constructs. Nucleic Acids Research, 34, D153-D157
Proper citation: RRID:Addgene_81066 Copy
Species: Fungia coccina
Genetic Insert: mKO1
Vector Backbone Description: Vector Backbone:pUCP30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26937640
Proper citation: RRID:Addgene_78477 Copy
Species: Aequorea victoria
Genetic Insert: eCFP
Vector Backbone Description: Vector Backbone:pUCP30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26937640
Comments: Please note that Addgene identified the presence of an eCFP fluorophore rather than the stated eYFP.
Proper citation: RRID:Addgene_78476 Copy
Vector Backbone Description: Backbone Size:4922; Vector Backbone:pJQ200; Vector Types:Suicide plasmid; Bacterial Resistance:Gentamicin
Defining Citation: PMID:8486283
Comments: This is the most popular version of the pJQ200 series of vectors. The partial lacZ alpha gene does give blue/white selection, but colonies are only pale blue after 24 hours. Blue colour is clear after 36 hrs. or by using higher x-gal concentration.
Proper citation: RRID:Addgene_78497 Copy
Vector Backbone Description: Backbone Size:6500; Vector Backbone:P15A origin vector pACYC184Gm; Vector Types:Suicide vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:8486283
Comments: Base vector for suicide vectors pJQ200SK, pJQ200KS, pJQ200mp18, pJQ200mp19 which have been quite widely used for allelic replacement in rhizobia and other bacteria. sacB gene provides basis for selection of double recombinants.
Proper citation: RRID:Addgene_78496 Copy
Vector Backbone Description: Backbone Marker:Jurgen Quandt; Backbone Size:4700; Vector Backbone:pJQ200; Vector Types:suicide vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:8486283
Comments: Cosmid version of suicide vector for gene replacement. Same as pJQ200SK except for addition of cos site.
Proper citation: RRID:Addgene_78499 Copy
Species: SARS-CoV-2
Genetic Insert: SARS-CoV-2 NSP3 A890D
Vector Backbone Description: Vector Backbone:pDON207; Vector Types:Mammalian Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34709727
Proper citation: RRID:Addgene_180069 Copy
Species: Lactococcus lactis
Genetic Insert: promoter CP13
Vector Backbone Description: Backbone Size:0; Vector Backbone:pJN105; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:11739756
Proper citation: RRID:Addgene_18986 Copy
Species: E.coli
Genetic Insert: araE
Vector Backbone Description: Backbone Size:0; Vector Backbone:pJAT13; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:11739756
Proper citation: RRID:Addgene_18987 Copy
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4316; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven Luciferase miR-shRNA
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCCACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25756 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Proper citation: RRID:Addgene_25758 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5180; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT
Proper citation: RRID:Addgene_25754 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
