Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: ΔN335 kinesin-1A
Vector Backbone Description: Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19812246
Proper citation: RRID:Addgene_31606 Copy
Species: Homo sapiens
Genetic Insert: BAI1-associated protein 2
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581
Proper citation: RRID:Addgene_31675 Copy
Species: Homo sapiens
Genetic Insert: TACE
Vector Backbone Description: Backbone Size:4716; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19595713
Proper citation: RRID:Addgene_31713 Copy
Species: Homo sapiens
Genetic Insert: Protein Phosphatase 1 Regulatory Subunit 12A
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581
Proper citation: RRID:Addgene_31669 Copy
Species: Mus musculus
Genetic Insert: miR-106a-363
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21454525
Comments: miR-106a-363 micro RNA sequence - caaagtgctaacagtgcaggtag
Proper citation: RRID:Addgene_31703 Copy
Species: Mus musculus
Genetic Insert: NLS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4678; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155
Proper citation: RRID:Addgene_31871 Copy
Genetic Insert: 24xPP7 Stem Loop Cassette
Vector Backbone Description: Vector Backbone:pCR4blunt; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21512033
Comments: The 24xPP7 stem loop cassettes in this plasmid were generated from two non-identical stem-loops to reduce unnecessary redundancy and the chance of recombination in bacteria. The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is:
taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt
Proper citation: RRID:Addgene_31864 Copy
Genetic Insert: GFP (including ATG start codon)
Vector Backbone Description: Backbone Marker:Koen De Smet Imperial College Medical School; Backbone Size:5497; Vector Backbone:pSODIT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:11250077
Comments: Plasmid can also be grown in mycobacteria.
Proper citation: RRID:Addgene_31851 Copy
Species: Rhodopseudomonas palustris
Genetic Insert: iRFP
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:7384; Vector Backbone:pShuttle-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21765402
Comments: For additional protocols on using iRFP in other tissue types please review:
Verkhusha. Deep-tissue photoacoustic tomography of a genetically encoded near-infrared fluorescent probe. Angewandte Chemie Int. Ed. 2012, 51: 1448-1451.
PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22213541/
For more information on in vivo imaging, please see:
https://www.addgene.org/fluorescent_proteins/in_vivo/
Proper citation: RRID:Addgene_31856 Copy
Vector Backbone Description: Backbone Marker:Addgene plasmid #21907; Backbone Size:8141; Vector Backbone:pSicoR-mCH; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20498046
Comments: The pSicoR-Ef1α-mCh-Puro lentiviral construct was created by replacing the CMV promoter of pSicoR-mCherry (Addgene vector 21907) with Ef1α and adding an in-frame T2A-puromycin-resistance gene cassette following mCherry. A single RNA molecule is generated for mCherry-T2A-puromycin and two polypeptides are produced by the T2A ribosomal skip motif. The shRNA coding oligos are cloned into the HpaI and XhoI restriction sites as described for pSicoR.
Proper citation: RRID:Addgene_31845 Copy
Vector Backbone Description: Backbone Marker:Addgene plasmid #21907; Backbone Size:7484; Vector Backbone:pSicoR-mCH; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20498046
Comments: The pSicoR-Ef1α-mCh lentiviral construct was created by replacing the CMV promoter of pSicoR-mCherry (Addgene vector 21907) with Ef1α.
The shRNA coding oligos are cloned into the HpaI and XhoI restriction sites as described for pSicoR.
Proper citation: RRID:Addgene_31847 Copy
Species: Mus musculus
Genetic Insert: Akt1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21147110
Proper citation: RRID:Addgene_31790 Copy
Species: Mus musculus
Genetic Insert: TAZ
Vector Backbone Description: Backbone Marker:Drs. S Lessnick and T. Golub (Dana-Farber Cancer Institute); Vector Backbone:pSRP; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16099986
Proper citation: RRID:Addgene_31795 Copy
Vector Backbone Description: Backbone Size:3216; Vector Backbone:pT3TS; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9891358
Proper citation: RRID:Addgene_31830 Copy
Genetic Insert: VSV genome
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21825165
Comments: This plasmid could potentially be used to generate BL2 virus. It is the responsibility of the recipient scientist to ensure that they are in compliance with their institutions’ biosafety requirements.
Proper citation: RRID:Addgene_31833 Copy
Species: Rattus norvegicus
Genetic Insert: p97
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822278
Comments: Contains NMHTG linker between myc and Strep tags.
The hygromycin resistance gene in this plasmid lacks a promoter and native start codon. See Invitrogen's website for more information about the vector backbone.
Proper citation: RRID:Addgene_31837 Copy
Species: Homo sapiens
Genetic Insert: achaete-scute complex homolog 1
Vector Backbone Description: Backbone Marker:home made/Crabtree lab; Backbone Size:8455; Vector Backbone:N106; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21753754
Proper citation: RRID:Addgene_31781 Copy
Vector Backbone Description: Backbone Size:9119; Vector Backbone:pGBT; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21552255
Comments: The plasmid contains Tol2 transposon mini ITRs.
Proper citation: RRID:Addgene_31828 Copy
Genetic Insert: GFP (lacking ATG start codon)
Vector Backbone Description: Backbone Marker:Koen De Smet Imperial College Medical School; Backbone Size:5497; Vector Backbone:pSODIT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:11250077
Comments: Plasmid can also be grown in mycobacteria.
Proper citation: RRID:Addgene_31820 Copy
Species: Homo sapiens
Genetic Insert: NeuroD2
Vector Backbone Description: Backbone Marker:home made/Crabtree lab; Backbone Size:8851; Vector Backbone:N174; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21753754
Proper citation: RRID:Addgene_31822 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
