Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 320 showing 6381 ~ 6400 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_31606

    This resource has 1+ mentions.

http://www.addgene.org/31606

Species: Mus musculus
Genetic Insert: ΔN335 kinesin-1A
Vector Backbone Description: Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19812246

Proper citation: RRID:Addgene_31606 Copy   


  • RRID:Addgene_31675

    This resource has 1+ mentions.

http://www.addgene.org/31675

Species: Homo sapiens
Genetic Insert: BAI1-associated protein 2
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581

Proper citation: RRID:Addgene_31675 Copy   


  • RRID:Addgene_31713

    This resource has 1+ mentions.

http://www.addgene.org/31713

Species: Homo sapiens
Genetic Insert: TACE
Vector Backbone Description: Backbone Size:4716; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19595713

Proper citation: RRID:Addgene_31713 Copy   


  • RRID:Addgene_31669

    This resource has 1+ mentions.

http://www.addgene.org/31669

Species: Homo sapiens
Genetic Insert: Protein Phosphatase 1 Regulatory Subunit 12A
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581

Proper citation: RRID:Addgene_31669 Copy   


  • RRID:Addgene_31703

    This resource has 1+ mentions.

http://www.addgene.org/31703

Species: Mus musculus
Genetic Insert: miR-106a-363
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21454525
Comments: miR-106a-363 micro RNA sequence - caaagtgctaacagtgcaggtag

Proper citation: RRID:Addgene_31703 Copy   


  • RRID:Addgene_31871

    This resource has 1+ mentions.

http://www.addgene.org/31871

Species: Mus musculus
Genetic Insert: NLS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4678; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31871 Copy   


  • RRID:Addgene_31864

    This resource has 10+ mentions.

http://www.addgene.org/31864

Genetic Insert: 24xPP7 Stem Loop Cassette
Vector Backbone Description: Vector Backbone:pCR4blunt; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21512033
Comments: The 24xPP7 stem loop cassettes in this plasmid were generated from two non-identical stem-loops to reduce unnecessary redundancy and the chance of recombination in bacteria. The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is: taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt

Proper citation: RRID:Addgene_31864 Copy   


  • RRID:Addgene_31851

    This resource has 1+ mentions.

http://www.addgene.org/31851

Genetic Insert: GFP (including ATG start codon)
Vector Backbone Description: Backbone Marker:Koen De Smet Imperial College Medical School; Backbone Size:5497; Vector Backbone:pSODIT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:11250077
Comments: Plasmid can also be grown in mycobacteria.

Proper citation: RRID:Addgene_31851 Copy   


  • RRID:Addgene_31856

    This resource has 1+ mentions.

http://www.addgene.org/31856

Species: Rhodopseudomonas palustris
Genetic Insert: iRFP
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:7384; Vector Backbone:pShuttle-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21765402
Comments: For additional protocols on using iRFP in other tissue types please review: Verkhusha. Deep-tissue photoacoustic tomography of a genetically encoded near-infrared fluorescent probe. Angewandte Chemie Int. Ed. 2012, 51: 1448-1451. PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22213541/ For more information on in vivo imaging, please see: https://www.addgene.org/fluorescent_proteins/in_vivo/

Proper citation: RRID:Addgene_31856 Copy   


  • RRID:Addgene_31845

    This resource has 10+ mentions.

http://www.addgene.org/31845

Vector Backbone Description: Backbone Marker:Addgene plasmid #21907; Backbone Size:8141; Vector Backbone:pSicoR-mCH; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20498046
Comments: The pSicoR-Ef1α-mCh-Puro lentiviral construct was created by replacing the CMV promoter of pSicoR-mCherry (Addgene vector 21907) with Ef1α and adding an in-frame T2A-puromycin-resistance gene cassette following mCherry. A single RNA molecule is generated for mCherry-T2A-puromycin and two polypeptides are produced by the T2A ribosomal skip motif. The shRNA coding oligos are cloned into the HpaI and XhoI restriction sites as described for pSicoR.

Proper citation: RRID:Addgene_31845 Copy   


  • RRID:Addgene_31847

    This resource has 10+ mentions.

http://www.addgene.org/31847

Vector Backbone Description: Backbone Marker:Addgene plasmid #21907; Backbone Size:7484; Vector Backbone:pSicoR-mCH; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20498046
Comments: The pSicoR-Ef1α-mCh lentiviral construct was created by replacing the CMV promoter of pSicoR-mCherry (Addgene vector 21907) with Ef1α. The shRNA coding oligos are cloned into the HpaI and XhoI restriction sites as described for pSicoR.

Proper citation: RRID:Addgene_31847 Copy   


  • RRID:Addgene_31790

    This resource has 1+ mentions.

http://www.addgene.org/31790

Species: Mus musculus
Genetic Insert: Akt1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21147110

Proper citation: RRID:Addgene_31790 Copy   


  • RRID:Addgene_31795

    This resource has 1+ mentions.

http://www.addgene.org/31795

Species: Mus musculus
Genetic Insert: TAZ
Vector Backbone Description: Backbone Marker:Drs. S Lessnick and T. Golub (Dana-Farber Cancer Institute); Vector Backbone:pSRP; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16099986

Proper citation: RRID:Addgene_31795 Copy   


  • RRID:Addgene_31830

    This resource has 1+ mentions.

http://www.addgene.org/31830

Vector Backbone Description: Backbone Size:3216; Vector Backbone:pT3TS; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9891358

Proper citation: RRID:Addgene_31830 Copy   


  • RRID:Addgene_31833

    This resource has 1+ mentions.

http://www.addgene.org/31833

Genetic Insert: VSV genome
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21825165
Comments: This plasmid could potentially be used to generate BL2 virus. It is the responsibility of the recipient scientist to ensure that they are in compliance with their institutions’ biosafety requirements.

Proper citation: RRID:Addgene_31833 Copy   


  • RRID:Addgene_31837

    This resource has 1+ mentions.

http://www.addgene.org/31837

Species: Rattus norvegicus
Genetic Insert: p97
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822278
Comments: Contains NMHTG linker between myc and Strep tags. The hygromycin resistance gene in this plasmid lacks a promoter and native start codon. See Invitrogen's website for more information about the vector backbone.

Proper citation: RRID:Addgene_31837 Copy   


  • RRID:Addgene_31781

    This resource has 1+ mentions.

http://www.addgene.org/31781

Species: Homo sapiens
Genetic Insert: achaete-scute complex homolog 1
Vector Backbone Description: Backbone Marker:home made/Crabtree lab; Backbone Size:8455; Vector Backbone:N106; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21753754

Proper citation: RRID:Addgene_31781 Copy   


  • RRID:Addgene_31828

    This resource has 1+ mentions.

http://www.addgene.org/31828

Vector Backbone Description: Backbone Size:9119; Vector Backbone:pGBT; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21552255
Comments: The plasmid contains Tol2 transposon mini ITRs.

Proper citation: RRID:Addgene_31828 Copy   


  • RRID:Addgene_31820

    This resource has 1+ mentions.

http://www.addgene.org/31820

Genetic Insert: GFP (lacking ATG start codon)
Vector Backbone Description: Backbone Marker:Koen De Smet Imperial College Medical School; Backbone Size:5497; Vector Backbone:pSODIT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:11250077
Comments: Plasmid can also be grown in mycobacteria.

Proper citation: RRID:Addgene_31820 Copy   


  • RRID:Addgene_31822

    This resource has 1+ mentions.

http://www.addgene.org/31822

Species: Homo sapiens
Genetic Insert: NeuroD2
Vector Backbone Description: Backbone Marker:home made/Crabtree lab; Backbone Size:8851; Vector Backbone:N174; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21753754

Proper citation: RRID:Addgene_31822 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X