Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
AMPK-β2-FLAG Resource Report Resource Website 1+ mentions |
RRID:Addgene_40603 | AMPK-β2 | Mus musculus | Kanamycin | PMID:17012231 | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:22:14 | 1 | ||
|
AMPK-β1-FLAG Resource Report Resource Website |
RRID:Addgene_40602 | AMPK-β1 | Mus musculus | Kanamycin | PMID:17012231 | Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:22:14 | 0 | ||
|
pCAGIG-6xHIS.Mm.RPE65-eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_41019 | RPE65 | Mus musculus | Ampicillin | This plasmid expresses EGFP as a reporter gene from IRES as part of the bicistronic transcript | Backbone Marker:Connie Cepko (Addgene plasmid #11159); Backbone Size:6135; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:22:16 | 1 | ||
|
pMCP-MU-Luc (MCP-1 mut promoter in pGL3-basic) Resource Report Resource Website |
RRID:Addgene_40325 | MCP-1 promoter (mutated) | Mus musculus | Ampicillin | PMID:10973278 | Note: Addgene NGS results identified an extra ~500 bp region upstream of the expected promoter, which contains a CMV enhancer feature. It is unknown what impact the region may have on plasmid function, but the extra sequence appears to have been present in the original sample received by Addgene. A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers: 5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start) 5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start) The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers: 5′–ATATCACCCGGGTCATGTATATGGCTTTCCAGGTCT–3′ 5′–TAGATTCTCGAGTGCACTTCTGGCTGCTCTGAGGCA–3′ and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic. For the construction of the MCP-1 mutant promoter, the BCL-6 site was mutated by a two step PCR–based strategy using the above flanking primers and the following complementary primers to mutate the BCL-6 site: 5′–TCTCTCTTCCACTTCCT[TT]AAACA–3′ 5′–TGTTT[AA]AGGAAGTGGAAGAGAGA–3′ (mutated bases are in brackets) The mutant promoter was cloned into pGL3 via XhoI and XmaI. The wild-type and mutant MCP-1 promoter sequences were verified by sequencing. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | contains MCP-1 promoter region through the nucleotides 28-bp downstream of the MCP-1 TATA site. Sequence has two base changes from the wild-type MCP-1 promoter around the -150 bp position (see note below). | 2026-08-25 09:22:13 | 0 |
|
mApple-Talin-C-18 Resource Report Resource Website |
RRID:Addgene_62738 | Talin | Mus musculus | Kanamycin | Vector Backbone:C1 Cloning Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | none | 2026-08-25 09:24:34 | 0 | ||
|
pTV-Oct4-TK-HMS Resource Report Resource Website |
RRID:Addgene_62351 | TK-Hyg-24xMS2 | Mus musculus | Ampicillin | PMID:26092696 | Backbone Size:6395; Vector Backbone:pBlueScript II SK (+); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:32 | 0 | ||
|
pGL3-Tet1 promoter A Resource Report Resource Website 1+ mentions |
RRID:Addgene_63881 | Tet1 promoter fragment A | Mus musculus | Ampicillin | PMID:25582196 | Backbone Size:4807; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:42 | 1 | ||
|
pGL3-Tet1 promoter B Resource Report Resource Website |
RRID:Addgene_63882 | Tet1 promoter fragment B | Mus musculus | Ampicillin | PMID:25582196 | Backbone Size:4807; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:42 | 0 | ||
|
pGL3-SV40P-Tet1 enhancer E Resource Report Resource Website |
RRID:Addgene_63880 | Tet1 enhancer fragment E | Mus musculus | Ampicillin | PMID:25582196 | Backbone Size:5005; Vector Backbone:pGL3-Promoter; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:42 | 0 | ||
|
pcDNA3.1 myc-mβTrCP WD1-7 (241-569) Resource Report Resource Website 1+ mentions |
RRID:Addgene_62977 | BTRC | Mus musculus | Ampicillin | PMID:25632159 | Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | codes for residues 241-569 | 2026-08-25 09:24:36 | 2 | |
|
pCMV5-Flag-HDAC3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_63676 | HDAC3 | Mus musculus | Ampicillin | PMID:16982804 | Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:40 | 2 | ||
|
BLBP-mCherry Resource Report Resource Website |
RRID:Addgene_63721 | BLBP | Mus musculus | Ampicillin | PMID:23345401 | Backbone Size:1700; Vector Backbone:pCAG-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 1700 bp upstream of BLBP gene cloned in CAG-mCherry | 2026-08-25 09:24:41 | 0 | |
|
pBa-eGFP-flag-BicD2 594-FKBP Resource Report Resource Website 1+ mentions |
RRID:Addgene_63569 | Bicaudal D protein | Mus musculus | Ampicillin | PMID:25624392 | pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination. XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains. | Backbone Size:7041; Vector Backbone:pBa-eGFP-FKBP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | no start methionine, aa1-594 | 2026-08-25 09:24:40 | 2 |
|
pMarsL274G Resource Report Resource Website 1+ mentions |
RRID:Addgene_63177 | MarsL274G | Mus musculus | Ampicillin | PMID:26991063 | Developed by Alborz Mahdavi. | Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | L274G | 2026-08-25 09:24:37 | 2 |
|
pBa-FRB-3myc-Rab5a Resource Report Resource Website 1+ mentions |
RRID:Addgene_64209 | Rab5a | Mus musculus | Ampicillin | PMID:25624392 | pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination. XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains. | Backbone Size:6280; Vector Backbone:pBa-FRB-3myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:44 | 1 | |
|
pBa-FRB-3myc-KIF13B tail 442-1826 Resource Report Resource Website 1+ mentions |
RRID:Addgene_64289 | KIF13B | Mus musculus | Ampicillin | PMID:25624392 | pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination. XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains. | Backbone Size:6287; Vector Backbone:pBa-FRB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa 442-1826 | 2026-08-25 09:24:45 | 1 |
|
pBa-FRB-3myc-KIF1B beta tail 387-1770 Resource Report Resource Website 1+ mentions |
RRID:Addgene_64287 | KIF1B beta | Mus musculus | Ampicillin | PMID:25624392 | pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination. XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains. | Backbone Size:6287; Vector Backbone:pBa-FRB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa 387-1770, small portion of 5'end matches rat, 3'end matches mouse. V407A, L536I, S542N, Y939C, Q1093R, T1187I, K1691E, and S1766N relative to NM_207682 | 2026-08-25 09:24:45 | 1 |
|
Ii-Str_ManII-SBP-tagBFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_65257 | Ii-Streptavidin and truncated Mannosidase II | Mus musculus | Kanamycin | PMID:22406856 | luminal tagging | Backbone Marker:Clontech; Vector Backbone:pIRESneo3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | contains only amino acids 1 to 116 of ManII | 2026-08-25 09:24:50 | 2 |
|
Str-KDEL_ManII-SBP-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_65253 | Streptavidin-KDEL and truncated Mannosidase II | Mus musculus | Ampicillin | PMID:22406856 | luminal tagging | Backbone Marker:Clontech; Vector Backbone:pIRES_neo3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | contains only amino acids 1 to 116 of ManII | 2026-08-25 09:24:50 | 3 |
|
Ii-Str_ManII-SBP-EGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_65255 | Ii-Streptavidin and truncated Mannosidase II | Mus musculus | Ampicillin | PMID:22406856 | luminal tagging | Backbone Marker:Clontech; Vector Backbone:pIRESneo3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | contains only amino acids 1 to 116 of ManII | 2026-08-25 09:24:50 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
