Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA3 PARL-FLAG-CT L79E Resource Report Resource Website |
RRID:Addgene_13640 | Presenilin-associated rhomboid-like | Homo sapiens | Ampicillin | PMID:14732705 | This mutation blocks PARL beta-cleavage without affecting the protein's rhomboid protease activity | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed Leu 79 to Glu | 2026-08-15 01:06:05 | 0 |
|
pKLV-gRNA-CTBP2-MGMT_1 Resource Report Resource Website |
RRID:Addgene_136419 | U6_sgRNA(CTBP2)_U6_sgRNA(MGMT) | Homo sapiens | Ampicillin | Backbone Marker:Addgene #50946; Vector Backbone:pKLV-U6gRNA-PGKpuro2ABFP; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:06:05 | 0 | |||
|
pLJM1-4EBP1-T37A/T46A Resource Report Resource Website |
RRID:Addgene_136420 | eIF4EBP1 | Homo sapiens | Ampicillin | Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | T37A/T46A | 2026-08-15 01:06:05 | 0 | ||
|
pCEP4-myc-PDGFRalpha Resource Report Resource Website |
RRID:Addgene_136434 | PDGFRalpha | Homo sapiens | Ampicillin | PMID:32559251 | Backbone Marker:Invitrogen; Backbone Size:10381; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:06:05 | 0 | ||
|
pcDNA3-sPDGFRalpha-Fc (Legacy) Resource Report Resource Website |
RRID:Addgene_136437 | PDGFRalpha | Homo sapiens | Ampicillin | PMID:32559251 | Backbone Marker:Invitrogen; Backbone Size:5332; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Extracellular domain of PDGFR-alpha (a.a. 1-524) | 2026-08-15 01:06:05 | 0 | |
|
pcDNA3-sPDGFRalpha-Fc Resource Report Resource Website |
RRID:Addgene_136438 | PDGFRalpha | Homo sapiens | Ampicillin | PMID:32559251 | Backbone Marker:Invitrogen; Backbone Size:5332; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Extracellular domain of PDGFR-alpha (a.a. 1-524) | 2026-08-15 01:06:05 | 0 | |
|
pGEX2T E7 C91S Resource Report Resource Website |
RRID:Addgene_13653 | HPV 16 E7 C91S | Homo sapiens | Ampicillin | PMID:8445736 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 91 C to S | 2026-08-15 01:06:06 | 0 | |
|
pGEX2T E7 H2P Resource Report Resource Website |
RRID:Addgene_13654 | HPV 16 E7 H2P | Homo sapiens | Ampicillin | PMID:8445736 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 2 from H to P | 2026-08-15 01:06:08 | 0 | |
|
pGEX2T E7 del L67 Resource Report Resource Website |
RRID:Addgene_13652 | HPV 16 E7 del L67 | Homo sapiens | Ampicillin | PMID:8445736 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | del aa 67 | 2026-08-15 01:06:06 | 0 | |
|
pGEX2T E7 L67K Resource Report Resource Website |
RRID:Addgene_13650 | HPV 16 E7 L67K | Homo sapiens | Ampicillin | PMID:8445736 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 67 from L to K | 2026-08-15 01:06:08 | 0 | |
|
pCEP4-myc-PDGFRbeta Resource Report Resource Website 1+ mentions |
RRID:Addgene_136455 | PDGFRbeta | Homo sapiens | Ampicillin | PMID:32559251 | Backbone Marker:Invitrogen; Backbone Size:10381; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:06:06 | 1 | ||
|
pBABE_hygro_mRFP1_NRF2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_136579 | NRF2 | Homo sapiens | Ampicillin | PMID:32291314 | Backbone Marker:Addgene #1765; Backbone Size:5219; Vector Backbone:pBABE-hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:06:07 | 2 | ||
|
pSico_U6-PLOD2 sgRNA4 Resource Report Resource Website |
RRID:Addgene_136459 | gRNA against human PLOD2 | Homo sapiens | Ampicillin | PMID:34107376 | Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:06:07 | 0 | ||
|
pSico_U6-PLOD2 sgRNA5 Resource Report Resource Website |
RRID:Addgene_136460 | gRNA against human PLOD2 | Homo sapiens | Ampicillin | PMID:34107376 | Backbone Size:9580; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:06:06 | 0 | ||
|
DHB-mVenus Resource Report Resource Website 1+ mentions |
RRID:Addgene_136461 | DNA Helicase B | Homo sapiens | Ampicillin | PMID:24075009 | Backbone Size:9136; Vector Backbone:CSII-EF-MCS; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:06:07 | 6 | ||
|
pGEX2T E7 Q Resource Report Resource Website |
RRID:Addgene_13648 | HPV 16 E7 Q mutant | Homo sapiens | Ampicillin | PMID:8445736 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 30-37 changed from DSSEEEDE to QSSQQQQQ. | 2026-08-15 01:06:08 | 0 | |
|
pGEX2T E7 L67R Resource Report Resource Website |
RRID:Addgene_13649 | HPV 16 E7 L67R | Homo sapiens | Ampicillin | PMID:8445736 | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 67 from L to R | 2026-08-15 01:06:06 | 0 | |
|
pEN_TTmiRC2_3xflag_NRF2(RR) Resource Report Resource Website 1+ mentions |
RRID:Addgene_136522 | NRF2(1584A>C,1586A>T,1589A>G) | Homo sapiens | Gentamicin | PMID:32291314 | Backbone Marker:Addgene #83274; Backbone Size:4422; Vector Backbone:pEN_TT miRc2 3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | This plasmid is developed by mutating 3 base pairs within the sequence targeted by shNRF2 version 1 (c.1584A>C,c.1586A>T,c.1589A>G) of NRF2 sequence in the pEN_TTmiRc2_3xflag_NRF2 plasmid using QuickChange II XL site-directed mutagenesis kit to create an RNAi-resistant version of NRF2. These base pair changes do not change the amino acid sequence, but switch the codons to rare codons in the human genome. Primer used: ctggaaaatatagtagaactagagcaagatttcgttcgtttgaaagatgaaaaagaaaaattgctcaaa | 2026-08-15 01:06:06 | 1 | |
|
pEN_TTmiRc2_p53(R280K)_V5 Resource Report Resource Website |
RRID:Addgene_136525 | p53(R280K) | Homo sapiens | Gentamicin | PMID:32291314 | Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | p53(R280K)V5 was cloned from pLenti6-p53-R280K-V5 plasmid from Addgene (plasmid #22933) with SpeI and MfeI 5' and 3' sites, respectively. There is a C --> G polymorphism at base pair 215 in ORF (corresponding to codon 72- switching from a proline to an arginine). This base pair substitution was encoded in the insert in the pLenti6 plasmid obtained from Addgene and is a common sequence polymorphism observed in p53. | 2026-08-15 01:06:06 | 0 | |
|
pEN_TTmiRc2_3xflag_CHEK2 Resource Report Resource Website |
RRID:Addgene_136526 | CHEK2 | Homo sapiens | Gentamicin | PMID:32291314 | Backbone Marker:Addgene #83274; Backbone Size:4496; Vector Backbone:pEN_TT miRc2 3xFLAG; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-15 01:06:08 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
