Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: EB1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_39306 Copy
Species: Homo sapiens
Genetic Insert: EB1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_39302 Copy
Species: Homo sapiens
Genetic Insert: EB1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_39301 Copy
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5438; Vector Backbone:pET26b(+); Vector Types:Bacterial Expression, Bacterial expression, bacterial expression of recombinant antibody fragments in the form of single chain Fvs (scFvs); Bacterial Resistance:Kanamycin
Defining Citation: PMID:17156422
Proper citation: RRID:Addgene_39264 Copy
Genetic Insert: RAJ31 system
Vector Backbone Description: Backbone Marker:Jaramillo Lab; Backbone Size:4860; Vector Backbone:pSTC1; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22949707
Proper citation: RRID:Addgene_39255 Copy
Genetic Insert: RAJ31 system (no terminator for the transRNA)
Vector Backbone Description: Backbone Marker:Jaramillo Lab; Backbone Size:4860; Vector Backbone:pSTC1; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22949707
Proper citation: RRID:Addgene_39257 Copy
Genetic Insert: RAJ22 system (no transRNA)
Vector Backbone Description: Backbone Marker:Jaramillo Lab; Backbone Size:4042; Vector Backbone:pSTC0; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22949707
Proper citation: RRID:Addgene_39252 Copy
Genetic Insert: RAJ22 system
Vector Backbone Description: Backbone Marker:Jaramillo Lab; Backbone Size:4042; Vector Backbone:pSTC0; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22949707
Proper citation: RRID:Addgene_39251 Copy
Genetic Insert: RAJ23 system
Vector Backbone Description: Backbone Marker:Jaramillo Lab; Backbone Size:4042; Vector Backbone:pSTC0; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:22949707
Proper citation: RRID:Addgene_39253 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-25-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCGGCGAGCTGCACG
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb
Proper citation: RRID:Addgene_39407 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-25-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCAAGATCCGCCACA
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb
Proper citation: RRID:Addgene_39406 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-23-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCGTCCTTGAAGAAG
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb
Proper citation: RRID:Addgene_39403 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-24-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTGCCGTCCTCCTTG
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb
Proper citation: RRID:Addgene_39405 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-06-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TGCCACCTACG
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb
Proper citation: RRID:Addgene_39368 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-05-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TAGGTGGCATC
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb
Proper citation: RRID:Addgene_39367 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-22-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TGGTGCCCATCCTGG
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2kb and 5.8kb
Proper citation: RRID:Addgene_39400 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-07-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TGCACGCCGTA
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.6kb and 5.8kb
Proper citation: RRID:Addgene_39371 Copy
Genetic Insert: burs-mCD8-EGFP-T2A-Gal4
Vector Backbone Description: Backbone Size:8491; Vector Backbone:pC-attB; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22209908
Proper citation: RRID:Addgene_39463 Copy
Genetic Insert: mCD8-F2A-Gal4
Vector Backbone Description: Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22209908
Proper citation: RRID:Addgene_39459 Copy
Species: Homo sapiens
Genetic Insert: eGFP-TALEN-48-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTGAAGTCGATGCCCTTCAGC
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.6kb and 5.8kb
Proper citation: RRID:Addgene_39453 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.