Plasmids   Select Another Resource Report Type

http://www.addgene.org/32283

Species: Danio rerio
Genetic Insert: TAL array targeting gria3a
Vector Backbone Description: Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: WT

Proper citation: RRID:Addgene_32283 Copy   

•   Source: Addgene

http://www.addgene.org/32279

Species: Danio rerio
Genetic Insert: TAL array targeting hey2
Vector Backbone Description: Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: WT

Proper citation: RRID:Addgene_32279 Copy   

•   Source: Addgene

http://www.addgene.org/32385

Genetic Insert: Peredox-mCherry-NLS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:pMSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21982714

Proper citation: RRID:Addgene_32385 Copy   

•   Source: Addgene

http://www.addgene.org/32382

Genetic Insert: His7-Peredox-mCherry
Vector Backbone Description: Backbone Marker:InVitrogen; Backbone Size:2300; Vector Backbone:pRSetB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21982714

Proper citation: RRID:Addgene_32382 Copy   

•   Source: Addgene

http://www.addgene.org/32426

Genetic Insert: Flag-mCherry-T2A-GFP-T2A-neo
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:Ac5/V5-HIS; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22355594
Comments: For multicistronic expression in insect cells. FLAG-mCherry, GFP, or Neo can be removed or replaced. N-terminal or C-terminal fusions to either FLAG-mCherry or GFP are possible. Note: mCherry DNA sequence is modified from original Tsien sequence (AA sequence is unchanged). AA sequence of T2A peptides is identical, but DNA sequence differs.

Proper citation: RRID:Addgene_32426 Copy   

•   Source: Addgene

http://www.addgene.org/32374

Vector Backbone Description: Vector Backbone:pTRIamp19 vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17961538
Comments: This plasmid is the same as Plasmid #122139.

Proper citation: RRID:Addgene_32374 Copy   

•   Source: Addgene

http://www.addgene.org/32378

Genetic Insert: int Giles; gfpm2+; xylEm; ttsbiA, ttsbiB
Vector Backbone Description: Vector Backbone:pML603; Vector Types:bacterial integration vector; Bacterial Resistance:Hygromycin
Defining Citation: PMID:20692326
Comments: This is an improved Giles integration vector for stable gene integration in mycobacteria with codon optimized gfp and xylE as reporter genes; terminators to protect expression cassette against transcriptional interference.

Proper citation: RRID:Addgene_32378 Copy   

•   Source: Addgene

http://www.addgene.org/32416

Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P5-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812

Proper citation: RRID:Addgene_32416 Copy   

•   Source: Addgene

http://www.addgene.org/32414

Genetic Insert: oPRE
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P5-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Comments: Gene Therapy (2006) 13, 641–645. doi:10.1038/sj.gt.3302698; published online 15 December 2005 'Woodchuck hepatitis virus post-transcriptional regulatory element deleted from X protein and promoter sequences enhances retroviral vector titer and expression. Schambach A, Bohne J, Baum C, Hermann FG, Egerer L, von Laer D, Giroglou T. Gene Ther. 2006 Apr;13(7):641-5.' Addgene Sanger sequencing confirms that all four ATGs in the oPRE have been mutated to TAGs

Proper citation: RRID:Addgene_32414 Copy   

•   Source: Addgene

http://www.addgene.org/32365

Species: Mus musculus
Genetic Insert: Mdm2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15090541

Proper citation: RRID:Addgene_32365 Copy   

•   Source: Addgene

http://www.addgene.org/32402

Vector Backbone Description: Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18296487
Comments: Please note that Addgene's sequencing result found a 60 nucleotide insert between bp#750/751 when compared to the full plasmid sequence provided by the depositing scientist. The depositing scientist confirmed that Addgene's sequence is correct--the insertion is located downstream of the CD4 bio coding sequence and is not a concern for protein expression.

Proper citation: RRID:Addgene_32402 Copy   

•   Source: Addgene

http://www.addgene.org/32403

Vector Backbone Description: Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18296487
Comments: Please note that Addgene's sequencing result with the rCD4-F primer found a single nucleotide mismatch at bp# 858, when compared to the full plasmid sequence provided by the depositing scientist. According to the depositing scientist, this is a silent mutation in the COMP domain of the protein and should not affect protein expression.

Proper citation: RRID:Addgene_32403 Copy   

•   Source: Addgene

http://www.addgene.org/32549

Genetic Insert: eGFP
Vector Backbone Description: Backbone Marker:Schmidt-Dannert Lab; Backbone Size:4138; Vector Backbone:pBBRBB; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22033566

Proper citation: RRID:Addgene_32549 Copy   

•   Source: Addgene

http://www.addgene.org/32496

Species: Homo sapiens
Genetic Insert: GSK3B
Vector Backbone Description: Backbone Marker:Sabatini Lab; Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19258413

Proper citation: RRID:Addgene_32496 Copy   

•   Source: Addgene

http://www.addgene.org/32530

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Multiple cloning site (MCS) was changed from SfiI, EcoRI, SalI, BglII, XhoI, KpnI and NotI to match the MCS of the pCAGIG vector (Addgene plasmid #11159) EcoRI, XhoI, EcoRV and NotI. This changes the frame for fusion to the HA tag. Top oligo: 5'- AGGAATTCCTCGAGGATATCGC -3' and Bottom oligo 5'- GGCCGCGATATCCTCGAGGAATTCCTCCA -3' were annealed and ligated into SfiI/NotI cut pCMV-HA. The SfiI site was destroyed in the process.

Proper citation: RRID:Addgene_32530 Copy   

•   Source: Addgene

http://www.addgene.org/32534

Species: Mus musculus
Genetic Insert: E1, ubiquitin-activating enzyme
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET-28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22012022

Proper citation: RRID:Addgene_32534 Copy   

•   Source: Addgene

http://www.addgene.org/32485

Vector Backbone Description: Backbone Marker:Mo Bi Tec; Vector Backbone:PET01; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18930792

Proper citation: RRID:Addgene_32485 Copy   

•   Source: Addgene

http://www.addgene.org/32520

Species: Rattus norvegicus
Genetic Insert: Constitutively active Rheb (S16H)
Vector Backbone Description: Backbone Marker:Addgene plasmid #32519; Vector Backbone:pHAGE-CMV-Rheb-IRES-eGFP-W; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20062052
Comments: The constitutively activating S16H mutation was introduced to pHAGE-CMV-Rheb-IRES-eGFP-W (Addgene plasmid #32519) by site directed mutagenesis. The original pHAGE-CMV-IRES lentiviral vector is from Dr Richard C. Mulligan at Harvard (Mostoslavsky G et al., 2005).

Proper citation: RRID:Addgene_32520 Copy   

•   Source: Addgene

http://www.addgene.org/32481

Species: Homo sapiens
Genetic Insert: PSAML141F,Y115F-GlyR
Vector Backbone Description: Backbone Size:5100; Vector Backbone:AAV2; Vector Types:AAV, Cre/Lox, Adeno-associated virus, FLEX switch; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21885782
Comments: Comments: These rAAV vectors are prone to recombination. This is a well known issue with these rAAV vectors and is due to the inverted terminal repeats (ITRs) required for rAAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C. Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended. Because recombination may still happen, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with Sma1 and Msc1 should be performed. The expected patterns can be calculated from the attached sequence. In Magnus et al, the PSAMY115F,L141F-GlyR channel was emphasized for silencing because this channel has the lowest acetylcholine responsiveness. However, PSAML141F-GlyR constructs, lacking the Y115F mutation, already have low ACh potency. The Y115F mutation also slightly increases the EC50 for the activator ligand, PSEM89S. Since PSAML141F-GlyR constructs already have very low acetylcholine potency, in many cases it may not be worth the slight reduction in PSEM potency. We have made both constructs available for researchers who may find that they have different requirements with respect to acetylcholine responsiveness.

Proper citation: RRID:Addgene_32481 Copy   

•   Source: Addgene

http://www.addgene.org/32475

Species: Homo sapiens
Genetic Insert: PSAMQ79G,Q139G-5HT3HC
Vector Backbone Description: Backbone Size:5100; Vector Backbone:AAV2; Vector Types:AAV, Cre/Lox, Adeno-associated virus, FLEX switch; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21885782
Comments: These rAAV vectors are prone to recombination. This is a well known issue with these rAAV vectors and is due to the inverted terminal repeats (ITRs) required for rAAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C. Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended. Because recombination may still happen, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with Sma1 and Msc1 should be performed. The expected patterns can be calculated from the attached sequence.

Proper citation: RRID:Addgene_32475 Copy   

•   Source: Addgene