Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
TALEN1295 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32283 | TAL array targeting gria3a | Danio rerio | Ampicillin | PMID:21822241 | TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: WT | Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:40 | 2 | |
|
TALEN1297 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32279 | TAL array targeting hey2 | Danio rerio | Ampicillin | PMID:21822241 | TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: WT | Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:40 | 4 | |
|
pMSCV-Peredox-mCherry-NLS Resource Report Resource Website 1+ mentions |
RRID:Addgene_32385 | Peredox-mCherry-NLS | Ampicillin | PMID:21982714 | Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:pMSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:45 | 3 | |||
|
pRsetB-His7tag-Peredox-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_32382 | His7-Peredox-mCherry | Ampicillin | PMID:21982714 | Backbone Marker:InVitrogen; Backbone Size:2300; Vector Backbone:pRSetB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:45 | 2 | |||
|
Ac5-STABLE2-neo Resource Report Resource Website 10+ mentions |
RRID:Addgene_32426 | Flag-mCherry-T2A-GFP-T2A-neo | Ampicillin | PMID:22355594 | For multicistronic expression in insect cells. FLAG-mCherry, GFP, or Neo can be removed or replaced. N-terminal or C-terminal fusions to either FLAG-mCherry or GFP are possible. Note: mCherry DNA sequence is modified from original Tsien sequence (AA sequence is unchanged). AA sequence of T2A peptides is identical, but DNA sequence differs. | Backbone Marker:Invitrogen; Vector Backbone:Ac5/V5-HIS; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:41 | 28 | ||
|
pIVT Resource Report Resource Website 1+ mentions |
RRID:Addgene_32374 | Ampicillin | PMID:17961538 | This plasmid is the same as Plasmid #122139. | Vector Backbone:pTRIamp19 vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:45 | 1 | |||
|
pML1357 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32378 | int Giles; gfpm2+; xylEm; ttsbiA, ttsbiB | Hygromycin | PMID:20692326 | This is an improved Giles integration vector for stable gene integration in mycobacteria with codon optimized gfp and xylE as reporter genes; terminators to protect expression cassette against transcriptional interference. | Vector Backbone:pML603; Vector Types:bacterial integration vector; Bacterial Resistance:Hygromycin | 2026-08-15 01:13:40 | 2 | ||
|
pENTR-L5-mCherry-L2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32416 | mCherry | Kanamycin | PMID:21772812 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P5-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:41 | 1 | |||
|
pENTR-L5-oPRE-L2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32414 | oPRE | Kanamycin | PMID:21772812 | Gene Therapy (2006) 13, 641–645. doi:10.1038/sj.gt.3302698; published online 15 December 2005 'Woodchuck hepatitis virus post-transcriptional regulatory element deleted from X protein and promoter sequences enhances retroviral vector titer and expression. Schambach A, Bohne J, Baum C, Hermann FG, Egerer L, von Laer D, Giroglou T. Gene Ther. 2006 Apr;13(7):641-5.' Addgene Sanger sequencing confirms that all four ATGs in the oPRE have been mutated to TAGs | Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P5-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | WPRE with deletion of X protein promoter and mutation of all four ATGs which are followed by an ORF encoding more than 25 amino acids | 2026-08-15 01:13:45 | 1 | |
|
PGL3Basic-Mdm2-T1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32365 | Mdm2 promoter | Mus musculus | Ampicillin | PMID:15090541 | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:45 | 1 | ||
|
CD4d3+4-bio Resource Report Resource Website 1+ mentions |
RRID:Addgene_32402 | Ampicillin | PMID:18296487 | Please note that Addgene's sequencing result found a 60 nucleotide insert between bp#750/751 when compared to the full plasmid sequence provided by the depositing scientist. The depositing scientist confirmed that Addgene's sequence is correct--the insertion is located downstream of the CD4 bio coding sequence and is not a concern for protein expression. | Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:41 | 2 | |||
|
CD4d3+4-blac Resource Report Resource Website 1+ mentions |
RRID:Addgene_32403 | Ampicillin | PMID:18296487 | Please note that Addgene's sequencing result with the rCD4-F primer found a single nucleotide mismatch at bp# 858, when compared to the full plasmid sequence provided by the depositing scientist. According to the depositing scientist, this is a silent mutation in the COMP domain of the protein and should not affect protein expression. | Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:45 | 1 | |||
|
pBBRBB-eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_32549 | eGFP | Kanamycin | PMID:22033566 | Backbone Marker:Schmidt-Dannert Lab; Backbone Size:4138; Vector Backbone:pBBRBB; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:47 | 2 | |||
|
pLKO.1-GSK3β-#1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32496 | GSK3B | Homo sapiens | Ampicillin | PMID:19258413 | Backbone Marker:Sabatini Lab; Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:41 | 7 | ||
|
pCMV-HA (New MCS) Resource Report Resource Website 10+ mentions |
RRID:Addgene_32530 | Ampicillin | Multiple cloning site (MCS) was changed from SfiI, EcoRI, SalI, BglII, XhoI, KpnI and NotI to match the MCS of the pCAGIG vector (Addgene plasmid #11159) EcoRI, XhoI, EcoRV and NotI. This changes the frame for fusion to the HA tag. Top oligo: 5'- AGGAATTCCTCGAGGATATCGC -3' and Bottom oligo 5'- GGCCGCGATATCCTCGAGGAATTCCTCCA -3' were annealed and ligated into SfiI/NotI cut pCMV-HA. The SfiI site was destroyed in the process. | Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:47 | 20 | ||||
|
pET28-mE1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_32534 | E1, ubiquitin-activating enzyme | Mus musculus | Kanamycin | PMID:22012022 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET-28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:47 | 21 | ||
|
pSpliceExpress Resource Report Resource Website 10+ mentions |
RRID:Addgene_32485 | Chloramphenicol and Ampicillin | PMID:18930792 | Backbone Marker:Mo Bi Tec; Vector Backbone:PET01; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:13:41 | 16 | ||||
|
pHAGE-CMV-Rheb(S16H)-IRES-eGFP-W Resource Report Resource Website 1+ mentions |
RRID:Addgene_32520 | Constitutively active Rheb (S16H) | Rattus norvegicus | Ampicillin | PMID:20062052 | The constitutively activating S16H mutation was introduced to pHAGE-CMV-Rheb-IRES-eGFP-W (Addgene plasmid #32519) by site directed mutagenesis. The original pHAGE-CMV-IRES lentiviral vector is from Dr Richard C. Mulligan at Harvard (Mostoslavsky G et al., 2005). | Backbone Marker:Addgene plasmid #32519; Vector Backbone:pHAGE-CMV-Rheb-IRES-eGFP-W; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | S16H to make constitutively active | 2026-08-15 01:13:42 | 2 |
|
rAAV-syn::FLEX-rev::PSAML141F,Y115F:GlyR-IRES-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_32481 | PSAML141F,Y115F-GlyR | Homo sapiens | Ampicillin | PMID:21885782 | Comments: These rAAV vectors are prone to recombination. This is a well known issue with these rAAV vectors and is due to the inverted terminal repeats (ITRs) required for rAAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C. Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended. Because recombination may still happen, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with Sma1 and Msc1 should be performed. The expected patterns can be calculated from the attached sequence. In Magnus et al, the PSAMY115F,L141F-GlyR channel was emphasized for silencing because this channel has the lowest acetylcholine responsiveness. However, PSAML141F-GlyR constructs, lacking the Y115F mutation, already have low ACh potency. The Y115F mutation also slightly increases the EC50 for the activator ligand, PSEM89S. Since PSAML141F-GlyR constructs already have very low acetylcholine potency, in many cases it may not be worth the slight reduction in PSEM potency. We have made both constructs available for researchers who may find that they have different requirements with respect to acetylcholine responsiveness. | Backbone Size:5100; Vector Backbone:AAV2; Vector Types:AAV, Cre/Lox, Adeno-associated virus, FLEX switch; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:46 | 4 | |
|
rAAV-syn::FLEX-rev::PSAMQ79G,Q139G:5HT3HC-IRES-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_32475 | PSAMQ79G,Q139G-5HT3HC | Homo sapiens | Ampicillin | PMID:21885782 | These rAAV vectors are prone to recombination. This is a well known issue with these rAAV vectors and is due to the inverted terminal repeats (ITRs) required for rAAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C. Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended. Because recombination may still happen, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with Sma1 and Msc1 should be performed. The expected patterns can be calculated from the attached sequence. | Backbone Size:5100; Vector Backbone:AAV2; Vector Types:AAV, Cre/Lox, Adeno-associated virus, FLEX switch; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:46 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
