Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 324 showing 6461 ~ 6480 out of 178,387 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_39456

http://www.addgene.org/39456

Genetic Insert: mCD8-Gal4
Vector Backbone Description: Backbone Size:6392; Vector Backbone:pPac-PL; Vector Types:S2; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22209908

Proper citation: RRID:Addgene_39456 Copy   


http://www.addgene.org/39455

Species: Homo sapiens
Genetic Insert: HA-hTet1CDmu
Vector Backbone Description: Backbone Size:5321; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21496894

Proper citation: RRID:Addgene_39455 Copy   


  • RRID:Addgene_39450

http://www.addgene.org/39450

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-47-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTCATCTGCACCACCGGCAAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.6kb and 5.8kb

Proper citation: RRID:Addgene_39450 Copy   


  • RRID:Addgene_39446

    This resource has 1+ mentions.

http://www.addgene.org/39446

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-45-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTCAAGTCCGCCATGCCCGA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb

Proper citation: RRID:Addgene_39446 Copy   


  • RRID:Addgene_39445

http://www.addgene.org/39445

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-44-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TAGGTCAGGGTGGTCACGAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb

Proper citation: RRID:Addgene_39445 Copy   


  • RRID:Addgene_39444

http://www.addgene.org/39444

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-44-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TGCACCACCGGCAAGCTGCC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb

Proper citation: RRID:Addgene_39444 Copy   


  • RRID:Addgene_39441

http://www.addgene.org/39441

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-42-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TGTGGCGGATCTTGAAGTT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb

Proper citation: RRID:Addgene_39441 Copy   


  • RRID:Addgene_39440

http://www.addgene.org/39440

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-42-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCATGGCCGACAAGCAGAA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb

Proper citation: RRID:Addgene_39440 Copy   


  • RRID:Addgene_39439

http://www.addgene.org/39439

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-41-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TGTGGTCGGGGTAGCGGCT To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb

Proper citation: RRID:Addgene_39439 Copy   


  • RRID:Addgene_39436

http://www.addgene.org/39436

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-40-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TGAAGTTCATCTGCACCAC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb

Proper citation: RRID:Addgene_39436 Copy   


  • RRID:Addgene_39435

http://www.addgene.org/39435

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-39-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCAGGGTCAGCTTGCCGTA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb

Proper citation: RRID:Addgene_39435 Copy   


  • RRID:Addgene_39432

http://www.addgene.org/39432

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-38-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32290); Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: tgcagtgcttcagccgct To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb

Proper citation: RRID:Addgene_39432 Copy   


  • RRID:Addgene_39398

http://www.addgene.org/39398

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-21-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TACAACAGCCACAA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.9kb and 5.8kb

Proper citation: RRID:Addgene_39398 Copy   


  • RRID:Addgene_39434

http://www.addgene.org/39434

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-39-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCAGCGTGTCCGGCGAGGG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.4kb and 5.8kb

Proper citation: RRID:Addgene_39434 Copy   


  • RRID:Addgene_39433

http://www.addgene.org/39433

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-38-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32287); Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: tTGAAGAAGTCGTGCTGC To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb

Proper citation: RRID:Addgene_39433 Copy   


  • RRID:Addgene_39394

http://www.addgene.org/39394

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-19-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTCAGCGTGTCCGG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 1.9kb and 5.8kb

Proper citation: RRID:Addgene_39394 Copy   


  • RRID:Addgene_39430

http://www.addgene.org/39430

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-37-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TAAACGGCCACAAGTTCA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb

Proper citation: RRID:Addgene_39430 Copy   


  • RRID:Addgene_39428

    This resource has 1+ mentions.

http://www.addgene.org/39428

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-36-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TCACCGGGGTGGTGCCCA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb

Proper citation: RRID:Addgene_39428 Copy   


  • RRID:Addgene_39425

http://www.addgene.org/39425

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-34-Right
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32288); Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTGTAGTTGTACTCCAG To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb

Proper citation: RRID:Addgene_39425 Copy   


  • RRID:Addgene_39424

http://www.addgene.org/39424

Species: Homo sapiens
Genetic Insert: eGFP-TALEN-34-Left
Vector Backbone Description: Backbone Marker:Joung lab (Addgene Plasmid # 32285); Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22484455
Comments: Target binding site: TTCAAGGAGGACGGCAA To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours. It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.2kb and 5.8kb

Proper citation: RRID:Addgene_39424 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X