Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pLKO.1P shNFS1_4
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_102966 shNFS1_4 Homo sapiens Ampicillin PMID:29168506 TRCN0000180881 Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:00:27 1
pHES609 [prNOp7-PBAC]
 
Resource Report
Resource Website
RRID:Addgene_103017 bPAC Saccharomyces cerevisiae Ampicillin PMID:28035051 Vector Backbone:pNH605; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:00:28 0
pUDE724
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_103023 crPDR12-3.S Saccharomyces cerevisiae Ampicillin PMID:29106617 Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:00:28 1
pLKO.1P shFXN_1
 
Resource Report
Resource Website
RRID:Addgene_102970 shFXN_1 Homo sapiens Ampicillin PMID:29168506 TRCN0000006138 Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:00:28 0
pUDE735
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_103024 crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S Saccharomyces cerevisiae Ampicillin PMID:29106617 Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:00:28 2
pUDE714
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_103021 crHIS4-4.S Saccharomyces cerevisiae Ampicillin PMID:29106617 Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:00:28 1
pUDE710
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_103020 crADE2-3.crHIS4-4.S Saccharomyces cerevisiae Ampicillin PMID:29106617 Backbone Marker:Świat M... Daran-Lapujade PAS FnCpf1, a novel and efficient genome editing tool for Saccharomyces cerevisiae. NAR; Backbone Size:4995; Vector Backbone:pUD628; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:00:28 2
pLKO.1P shSOD2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_102976 shSOD2 Homo sapiens Ampicillin PMID:29168506 TRCN0000005943 Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:00:28 2
pBabe hygro NFS1
 
Resource Report
Resource Website
RRID:Addgene_102977 NFS1 Homo sapiens Ampicillin PMID:29168506 Backbone Size:5578; Vector Backbone:pBabe hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Silent mutations to eliminate shNFS1_1 binding site 2026-08-15 01:00:27 0
pBabe hygro NFS1 CD
 
Resource Report
Resource Website
RRID:Addgene_102978 NFS1 C381A Homo sapiens Ampicillin PMID:29168506 Backbone Size:5578; Vector Backbone:pBabe hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin C381A catalytic site mutant, Silent mutations to eliminate shNFS1_1 binding site 2026-08-15 01:00:27 0
pLKO.1P shFXN_2
 
Resource Report
Resource Website
RRID:Addgene_102971 shFXN_2 Homo sapiens Ampicillin PMID:29168506 TRCN0000006137 Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:00:27 0
pLKO.1P shISCU
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_102972 shISCU Homo sapiens Ampicillin PMID:29168506 TRCN0000289988 Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO_TRC005; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:00:27 2
pLKO.1P shMOCS3_1
 
Resource Report
Resource Website
RRID:Addgene_102973 shMOCS3_1 Homo sapiens Ampicillin PMID:29168506 TRCN0000045642 Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:00:28 0
pUC19-A5EIM8
 
Resource Report
Resource Website
RRID:Addgene_103081 A5EIM8(Cas9 coding gene from Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)) Other Ampicillin PMID:29529247 Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin human codon-optimized 2026-08-15 01:00:29 0
pUC19-A8LN05
 
Resource Report
Resource Website
RRID:Addgene_103083 A8LN05(Cas9 coding gene from Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)) Other Ampicillin PMID:29529247 Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin human codon-optimized 2026-08-15 01:00:28 0
pUC19-A7HP89
 
Resource Report
Resource Website
RRID:Addgene_103082 A7HP89(Cas9 coding gene from Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)) Other Ampicillin PMID:29529247 Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin human codon-optimized 2026-08-15 01:00:28 0
pUC19-G9WGU4
 
Resource Report
Resource Website
RRID:Addgene_103112 G9WGU4(Cas9 coding gene from Oenococcus kitaharae DSM 17330) Other Ampicillin PMID:29529247 Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin human codon-optimized 2026-08-15 01:00:29 0
LSB-hsa-miR-127-3p
 
Resource Report
Resource Website
RRID:Addgene_103194 hsa-miR-127-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:00:30 0
LSB-hsa-miR-1271-5p
 
Resource Report
Resource Website
RRID:Addgene_103196 hsa-miR-1271-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:00:29 0
pUC19-K0XCK7
 
Resource Report
Resource Website
RRID:Addgene_103118 K0XCK7(Cas9 coding gene from Barnesiella intestinihominis YIT 11860) Other Ampicillin PMID:29529247 Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin human codon-optimized 2026-08-15 01:00:29 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.