Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: MSX1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9373945
Proper citation: RRID:Addgene_21024 Copy
Species: Mus musculus
Genetic Insert: HOXD4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: Mutation prevents interaction with PBX proteins
Proper citation: RRID:Addgene_21002 Copy
Species: Mus musculus
Genetic Insert: CBP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pSP65; Vector Types:in vitro TNT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11585930
Proper citation: RRID:Addgene_21089 Copy
Species: Mus musculus
Genetic Insert: CBP
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pSP65; Vector Types:in vitro TNT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11585930
Proper citation: RRID:Addgene_21088 Copy
Species: Mus musculus
Genetic Insert: HOXD4
Vector Backbone Description: Backbone Marker:Stratagene (originally); Backbone Size:4000; Vector Backbone:pBluescript derivative; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_21003 Copy
Species: Mus musculus
Genetic Insert: Brachyury promoter
Vector Backbone Description: Backbone Size:5461; Vector Backbone:SIN18; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19352491
Proper citation: RRID:Addgene_21063 Copy
Species: Mus musculus
Genetic Insert: Flag-tagged Mutant mouse BID
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pVMV-5a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9727492
Proper citation: RRID:Addgene_21133 Copy
Species: Mus musculus
Genetic Insert: alpha myosin heavy chain promoter
Vector Backbone Description: Backbone Size:6753; Vector Backbone:SMPU; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19352491
Proper citation: RRID:Addgene_21230 Copy
Species: Mus musculus
Genetic Insert: Brachyury promoter
Vector Backbone Description: Backbone Size:7838; Vector Backbone:SIN18; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19352491
Proper citation: RRID:Addgene_21222 Copy
Species: Mus musculus
Genetic Insert: neuron restrictive silencer factor
Vector Backbone Description: Backbone Marker:Didier Trono; Backbone Size:10000; Vector Backbone:pHR'; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12091564
Proper citation: RRID:Addgene_21310 Copy
Species: Mus musculus
Genetic Insert: ROSA26
Vector Backbone Description: Backbone Marker:Available at Addgene (Plasmid# 21714); Backbone Size:0; Vector Backbone:pROSA26-1; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11299042
Comments: To make the ROSA26 genomic sequence compatible with the pBigT plasmid, pROSA26-1 was digested with XbaI, Klenow filled and a linker (PacI, SwaI, AscI) inserted. This plasmid was called pROSA26PA.
Proper citation: RRID:Addgene_21271 Copy
Species: Mus musculus
Genetic Insert: Int3
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2900; Vector Backbone:pBSSK; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9576833
Proper citation: RRID:Addgene_21328 Copy
Species: Mus musculus
Genetic Insert: Ufd1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3000; Vector Backbone:pET26; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15371428
Comments: Addgene Next-generation sequencing QC processes identified that the insert harbors truncations of the region encoding the first 4 amino acids and final amino acid of Ufd1, relative to the NCBI reference sequence NM_011672
Proper citation: RRID:Addgene_21266 Copy
Species: Mus musculus
Genetic Insert: raptor shRNA 1
Vector Backbone Description: Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19150980
Comments: mouse raptor shRNA 1.
shRNA oligo sequence is 5'- CCGGCCTCATCGTCAAGTCCTTCAACTCGAGTTGAAGGACTTGACGATGAGGTTTTTG -3'
Proper citation: RRID:Addgene_21339 Copy
Species: Mus musculus
Genetic Insert: Notch4
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pHyTc; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_21469 Copy
Species: Mus musculus
Genetic Insert: NF-kappa-B p65 subunit
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4635; Vector Backbone:pIZT; Vector Types:Insect Expression, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:19481053
Proper citation: RRID:Addgene_21603 Copy
Species: Mus musculus
Genetic Insert: mitogen-activated protein kinase kinase 4
Vector Backbone Description: Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7997269
Comments: lysine mutant, inactive
missing first 10 amino acids
Proper citation: RRID:Addgene_21564 Copy
Species: Mus musculus
Genetic Insert: EGFP, Oct4
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:Bluescript; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18159219
Proper citation: RRID:Addgene_21547 Copy
Species: Mus musculus
Genetic Insert: Bmi-1
Vector Backbone Description: Backbone Marker:Ivanova, NB; Backbone Size:10130; Vector Backbone:FUGW-H1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371338
Comments: This plasmid targets the open reading frame of BMI-1. The 19mer target sequence is: GAGATAATAAGCTTGTCTA
Proper citation: RRID:Addgene_21576 Copy
Species: Mus musculus
Genetic Insert: ROSA26
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4486; Vector Backbone:pBluescript KS (-); Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9916792
Comments: General ROSA26-1 targeting vector. For more information visit - http://research.mssm.edu/soriano/lab
We recommend you order this plasmid along with SAbgeo and pROSA26-5' as a "ROSA26 targeting kit".
Please note that although the full plasmid sequence indicates PmeI does not cut the plasmid, there is a PmeI site somewhere in the plasmid. See Notes from Addgene link above for more information.
Proper citation: RRID:Addgene_21714 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
