Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Kif2A-alpha
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4706; Vector Backbone:PEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15883193
Comments: Depositor believes the mutation in Kif2a is the results of either errors in database sequences or polymorphisms.
Proper citation: RRID:Addgene_29481 Copy
Species: Homo sapiens
Genetic Insert: Rbx1 CUL1
Vector Backbone Description: Backbone Size:5136; Vector Backbone:pCool; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_29519 Copy
Species: Arabidopsis thaliana
Genetic Insert: ASK1
Vector Backbone Description: Backbone Size:0; Vector Backbone:pFB-HTB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20927106
Proper citation: RRID:Addgene_29517 Copy
Species: Arabidopsis thaliana
Genetic Insert: COI1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:0; Vector Backbone:pFastBac-GTE; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20927106
Proper citation: RRID:Addgene_29516 Copy
Species: Homo sapiens
Genetic Insert: FUS
Vector Backbone Description: Backbone Marker:Susan Lindquist (Addgene plasmid # 14220); Backbone Size:8203; Vector Backbone:pAG416GPD-ccdB-EYFP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21541367
Proper citation: RRID:Addgene_29594 Copy
Species: Homo sapiens
Genetic Insert: MKK4
Vector Backbone Description: Backbone Size:5961; Vector Backbone:pMCSG10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23790491
Comments: Starting Met removed.
Ligation-independent-cloning.
Proper citation: RRID:Addgene_29579 Copy
Species: Mus musculus
Genetic Insert: MKK7
Vector Backbone Description: Backbone Size:5961; Vector Backbone:pMCSG10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23790491
Comments: Ligation-independent cloning.
Proper citation: RRID:Addgene_29576 Copy
Species: Dendronephthya
Genetic Insert: mpx-Dendra 2
Vector Backbone Description: Backbone Size:3000; Vector Backbone:tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21248150
Comments: mpx is a promoter for neutrophil expression and was called zMPO in the associated publication
Proper citation: RRID:Addgene_29574 Copy
Species: Homo sapiens
Genetic Insert: FUS
Vector Backbone Description: Backbone Marker:Susan Lindquist (Addgene plasmid # 14227); Backbone Size:8126; Vector Backbone:pAG426Gal-ccdB-EYFP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21541367
Proper citation: RRID:Addgene_29592 Copy
Species: Homo sapiens
Genetic Insert: Huntingtin-interacting protein 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12163454
Proper citation: RRID:Addgene_29587 Copy
Species: Rattus norvegicus
Genetic Insert: Erk2
Vector Backbone Description: Backbone Size:5286; Vector Backbone:pMCSG7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23790491
Comments: Ligation-independent-cloning.
Proper citation: RRID:Addgene_29582 Copy
Vector Backbone Description: Backbone Size:4975; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2P-T has a TEV-cleavable N-terminal His6-Protein G fusion tag. Protein G can improve the expression and solubility of your target protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29713 Copy
Vector Backbone Description: Backbone Size:5131; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2T-T has a TEV-cleavable N-terminal His6-thioredoxin fusion tag. Thioredoxin can improve the solubility of your target protein by promoting correct disulfide bond formation.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29712 Copy
Vector Backbone Description: Backbone Size:5908; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2O-T has a TEV-cleavable N-terminal His6-Mocr fusion tag. Mocr can improve the expression and solubility of your target protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29710 Copy
Species: Homo sapiens
Genetic Insert: FUS RRM mutant
Vector Backbone Description: Backbone Marker:Susan Lindquist (Addgene plasmid # 14227); Backbone Size:8126; Vector Backbone:pAG426Gal-ccdB-EYFP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21541367
Proper citation: RRID:Addgene_29608 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:8106; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a SLIC cloning protocol.
Prescission is a highly specific protease that cleaves LEVLFQ/GP. It is generally more active than TEV protease, and many users have found that when their protein inhibits TEV cleavage, switching to a prescission vector has proved worthwhile.
To clone into this vector, add SLIC tags to the 5' end of your PCR primers.
Forward - 5'GTGCTGTTCCAGGGTCCGAAT3'
Reverse - 5'TGGTGGTGGTGGTGCTCGA(TTA)3'
Linearize the plasmid with SspI and XhoI, then gel purify. There is a 1650 bp stuffer sequence that will be visible on a gel.
When digesting the DNA with T4 polymerase, use no nucleotides for either your insert or the linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29721 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5661; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. Sumo can enhance the expression and solubility of your protein of interest.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/macrolab/
Proper citation: RRID:Addgene_29659 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5712; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. Mocr can enhance the expression and solubility of your protein of interest.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29658 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:6465; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. MBP can enhance your protein's solubility and expression. It can also be used as an affinity tag.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29656 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:6015; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. GST can be used to enhance your protein's expression and solubility. It can also be used as an affinity tag.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29655 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
