Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: DEXsynth:eGFP-ccdb + mcherry
Vector Backbone Description: Vector Backbone:pICH75322; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Tetracycline
Comments: This plasmid contains the Gateway technology from Invitrogen; Invitrogen requires purchasing of Gateway Clonase for carrying out the Gateway recombinational cloning reaction http://www.invitrogen.comPlease note that the full plasmid sequence is provided as a reference only, and may not match the exact sequence of the plasmid.
Proper citation: RRID:Addgene_233311 Copy
Species: Other
Genetic Insert: DEXsynth:ccdb-eGFP + mcherry
Vector Backbone Description: Vector Backbone:pICH75322; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Tetracycline
Comments: This plasmid contains the Gateway technology from Invitrogen; Invitrogen requires purchasing of Gateway Clonase for carrying out the Gateway recombinational cloning reaction http://www.invitrogen.comPlease note that the full plasmid sequence is provided as a reference only, and may not match the exact sequence of the plasmid.
Proper citation: RRID:Addgene_233312 Copy
Species: Other
Genetic Insert: Ubi:3xHA-ccdb + mcherry
Vector Backbone Description: Vector Backbone:pICH75322; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Tetracycline
Comments: This plasmid contains the Gateway technology from Invitrogen; Invitrogen requires purchasing of Gateway Clonase for carrying out the Gateway recombinational cloning reaction http://www.invitrogen.comPlease note that the full plasmid sequence is provided as a reference only, and may not match the exact sequence of the plasmid.
Proper citation: RRID:Addgene_233301 Copy
Species: Other
Genetic Insert: photoswitchable HaloTag 1a variant
Vector Backbone Description: Backbone Marker:EMBL; Backbone Size:5334; Vector Backbone:pCoofy1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41131894
Comments: Please visit https://doi.org/10.1101/2024.12.18.629107 for bioRxiv preprint.
Proper citation: RRID:Addgene_232940 Copy
Species: Other
Genetic Insert: DEXsynth:mTb-ccdb+ RUBY
Vector Backbone Description: Vector Backbone:pICH75322; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Tetracycline
Comments: This plasmid contains the Gateway technology from Invitrogen; Invitrogen requires purchasing of Gateway Clonase for carrying out the Gateway recombinational cloning reaction http://www.invitrogen.comPlease note that the full plasmid sequence is provided as a reference only, and may not match the exact sequence of the plasmid.
Proper citation: RRID:Addgene_233321 Copy
Species: Other
Genetic Insert: DEXsynth:ccdb-3xHA + RUBY
Vector Backbone Description: Vector Backbone:pICH75322; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Tetracycline
Comments: This plasmid contains the Gateway technology from Invitrogen; Invitrogen requires purchasing of Gateway Clonase for carrying out the Gateway recombinational cloning reaction http://www.invitrogen.comPlease note that the full plasmid sequence is provided as a reference only, and may not match the exact sequence of the plasmid.
Proper citation: RRID:Addgene_233319 Copy
Species: Other
Genetic Insert: Ubi:ccdb + mcherry
Vector Backbone Description: Vector Backbone:pICH75322; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Tetracycline
Comments: This plasmid contains the Gateway technology from Invitrogen; Invitrogen requires purchasing of Gateway Clonase for carrying out the Gateway recombinational cloning reaction http://www.invitrogen.comPlease note that the full plasmid sequence is provided as a reference only, and may not match the exact sequence of the plasmid.
Proper citation: RRID:Addgene_233303 Copy
Species: Other
Genetic Insert: Ubi:ccdb + RUBY
Vector Backbone Description: Vector Backbone:pICH75322; Vector Types:Gateway Cloning; Bacterial Resistance:Chloramphenicol and Tetracycline
Comments: This plasmid contains the Gateway technology from Invitrogen; Invitrogen requires purchasing of Gateway Clonase for carrying out the Gateway recombinational cloning reaction http://www.invitrogen.comPlease note that the full plasmid sequence is provided as a reference only, and may not match the exact sequence of the plasmid.
Proper citation: RRID:Addgene_233306 Copy
Species: Other
Genetic Insert: Anti-pTau nanobody (A2)
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961104
Comments: Please visit https://doi.org/10.1101/2023.10.24.563674 for bioRxiv preprint.
Proper citation: RRID:Addgene_233218 Copy
Species: Other
Genetic Insert: TurboID V5 T2A BFP
Vector Backbone Description: Vector Backbone:pLX303; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37577760
Proper citation: RRID:Addgene_233257 Copy
Species: Other
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:3773; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36109592
Proper citation: RRID:Addgene_191136 Copy
Species: Other
Genetic Insert: puromycin resistance cassette liked to a random 10N barcode
Vector Backbone Description: Backbone Marker:Jonathan Weissman; Vector Backbone:n.a.; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40705858
Proper citation: RRID:Addgene_238546 Copy
Species: Other
Genetic Insert: 8xHis-tag is attached to the N-terminus of rnhA (RNase HI) Kanamycin resistant gene is inserted upstream of rnhA
Vector Backbone Description: Vector Backbone:this is a strain; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37159417
Comments: Primers: (1)CACCAATCTCAATGATCTTGTGG, (2)CAGTCATAGCCGAATAGCCT, (3)CGGTGCCCTGAATGAACTGC, (4)GCGTCCGCGATAGCGTAAA. Expected product size: 666 bp with primer (1) and (2), 1042 bp with primer (3) and (4).
Guzit is a RNase HI(rnhA) His-tagged E. coli strain made for a cell-free expression system.
His-tagged RNase HI expressed from the rnhA gene can be removed using Ni-NTA resin upon the preparation of cell-free extract. A kanamycin resistant gene was inserted upstream of rnhA using the λ-Red recombination system.
Precuorsor strain is Rosseta 2.
Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501919v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_196902 Copy
Species: Other
Genetic Insert: "8xHis-tag is attached to the N-terminus of rnc (RNase III) Kanamycin resistant gene is inserted upstream of rnc"
Vector Backbone Description: Vector Backbone:this is a strain; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37159417
Comments: Primers: (1)AACGGCTATCTGGATGAGC, (2)CAGTCATAGCCGAATAGCCT, (3)CGGTGCCCTGAATGAACTGC, (4)CGATGAGTTAATGCCTGCTGCA. Expected product size: 842 bp with primer (1) and (2), 1038 bp with primer (3) and (4).
RNase III-His is an E. coli strain made for a cell-free expression system.
His-tagged RNase III expressed from the rnc gene can be removed using Ni-NTA resin upon the preparation of cell-free extract. A kanamycin resistant gene was inserted upstream of rnc using the λ-Red recombination system.
Precuorsor strain is Rosseta 2.
Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501919v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_196903 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230945 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230944 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230949 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230947 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230946 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230940 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
