Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 326 showing 6501 ~ 6520 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_103175

http://www.addgene.org/103175

Species: Homo sapiens
Genetic Insert: hsa-miR-107 target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103175 Copy   


  • RRID:Addgene_103191

http://www.addgene.org/103191

Species: Homo sapiens
Genetic Insert: hsa-miR-125b-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103191 Copy   


  • RRID:Addgene_103192

    This resource has 1+ mentions.

http://www.addgene.org/103192

Species: Homo sapiens
Genetic Insert: hsa-miR-126-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103192 Copy   


  • RRID:Addgene_103100

http://www.addgene.org/103100

Species: Other
Genetic Insert: E3HCA8(Cas9 coding gene from Ilyobacter polytropus (strain DSM 2926 / CuHBu1))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247

Proper citation: RRID:Addgene_103100 Copy   


  • RRID:Addgene_103187

http://www.addgene.org/103187

Species: Homo sapiens
Genetic Insert: hsa-miR-125a-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103187 Copy   


  • RRID:Addgene_103101

http://www.addgene.org/103101

Species: Other
Genetic Insert: E6I4Q5(Cas9 coding gene from Enterococcus faecalis TX0012)
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247

Proper citation: RRID:Addgene_103101 Copy   


  • RRID:Addgene_103184

http://www.addgene.org/103184

Species: Homo sapiens
Genetic Insert: hsa-miR-1249-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103184 Copy   


  • RRID:Addgene_103108

http://www.addgene.org/103108

Species: Other
Genetic Insert: F3UXG6(Cas9 coding gene from Streptococcus sanguinis SK49)
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247

Proper citation: RRID:Addgene_103108 Copy   


  • RRID:Addgene_103107

http://www.addgene.org/103107

Species: Other
Genetic Insert: F3QMY7(Cas9 coding gene from Parasutterella excrementihominis YIT 11859)
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247

Proper citation: RRID:Addgene_103107 Copy   


  • RRID:Addgene_103103

http://www.addgene.org/103103

Species: Other
Genetic Insert: E6WZS9(Cas9 coding gene from Nitratifractor salsuginis (strain DSM 16511 / JCM 12458 / E9I37-1))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247

Proper citation: RRID:Addgene_103103 Copy   


  • RRID:Addgene_103155

http://www.addgene.org/103155

Species: Homo sapiens
Genetic Insert: hsa-let-7f-2-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103155 Copy   


  • RRID:Addgene_103154

http://www.addgene.org/103154

Species: Homo sapiens
Genetic Insert: hsa-let-7f-1-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103154 Copy   


  • RRID:Addgene_103157

http://www.addgene.org/103157

Species: Homo sapiens
Genetic Insert: hsa-let-7g-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103157 Copy   


  • RRID:Addgene_103156

http://www.addgene.org/103156

Species: Homo sapiens
Genetic Insert: hsa-let-7f-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103156 Copy   


  • RRID:Addgene_103152

http://www.addgene.org/103152

Species: Homo sapiens
Genetic Insert: hsa-let-7e-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103152 Copy   


  • RRID:Addgene_103165

http://www.addgene.org/103165

Species: Homo sapiens
Genetic Insert: hsa-miR-101-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103165 Copy   


  • RRID:Addgene_103164

http://www.addgene.org/103164

Species: Homo sapiens
Genetic Insert: hsa-miR-100-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103164 Copy   


  • RRID:Addgene_103163

http://www.addgene.org/103163

Species: Homo sapiens
Genetic Insert: hsa-miR-100-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103163 Copy   


  • RRID:Addgene_103169

http://www.addgene.org/103169

Species: Homo sapiens
Genetic Insert: hsa-miR-105-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103169 Copy   


  • RRID:Addgene_103098

http://www.addgene.org/103098

Species: Other
Genetic Insert: E0XXB7(Cas9 coding gene from uncultured delta proteobacterium HF0070_07E19)
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247

Proper citation: RRID:Addgene_103098 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X