Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pMX155 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29481 | Kif2A-alpha | Mus musculus | Kanamycin | PMID:15883193 | Depositor believes the mutation in Kif2a is the results of either errors in database sequences or polymorphisms. | Backbone Marker:Clontech; Backbone Size:4706; Vector Backbone:PEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | E140K | 2026-08-15 01:13:20 | 1 |
|
pCool-mRbx1-His-hCul1-CTP Resource Report Resource Website 1+ mentions |
RRID:Addgene_29519 | Rbx1 CUL1 | Homo sapiens | Ampicillin | Backbone Size:5136; Vector Backbone:pCool; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:20 | 1 | |||
|
pFB-HTB-ASK1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29517 | ASK1 | Arabidopsis thaliana | Ampicillin | PMID:20927106 | Backbone Size:0; Vector Backbone:pFB-HTB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:20 | 1 | ||
|
pFB-GTE-COI1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29516 | COI1 | Arabidopsis thaliana | Ampicillin | PMID:20927106 | Backbone Marker:Invitrogen; Backbone Size:0; Vector Backbone:pFastBac-GTE; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Note that the first AA in TEV site is R, not E | 2026-08-15 01:13:20 | 1 | |
|
416GPD-FUS-YFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_29594 | FUS | Homo sapiens | Ampicillin | PMID:21541367 | Backbone Marker:Susan Lindquist (Addgene plasmid # 14220); Backbone Size:8203; Vector Backbone:pAG416GPD-ccdB-EYFP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:21 | 1 | ||
|
MKK4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29579 | MKK4 | Homo sapiens | Ampicillin | PMID:23790491 | Starting Met removed. Ligation-independent-cloning. | Backbone Size:5961; Vector Backbone:pMCSG10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:19 | 2 | |
|
MKK7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29576 | MKK7 | Mus musculus | Ampicillin | PMID:23790491 | Ligation-independent cloning. | Backbone Size:5961; Vector Backbone:pMCSG10; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Starting Met removed | 2026-08-15 01:13:19 | 1 |
|
tol2-mpx-Dendra2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29574 | mpx-Dendra 2 | Dendronephthya | Ampicillin | PMID:21248150 | mpx is a promoter for neutrophil expression and was called zMPO in the associated publication | Backbone Size:3000; Vector Backbone:tol2; Vector Types:; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:21 | 2 | |
|
426Gal-FUS-YFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_29592 | FUS | Homo sapiens | Ampicillin | PMID:21541367 | Backbone Marker:Susan Lindquist (Addgene plasmid # 14227); Backbone Size:8126; Vector Backbone:pAG426Gal-ccdB-EYFP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:21 | 1 | ||
|
pcDNA3/FLHIP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29587 | Huntingtin-interacting protein 1 | Homo sapiens | Ampicillin | PMID:12163454 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:21 | 1 | ||
|
Erk2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_29582 | Erk2 | Rattus norvegicus | Ampicillin | PMID:23790491 | Ligation-independent-cloning. | Backbone Size:5286; Vector Backbone:pMCSG7; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Starting Met removed from Erk2 | 2026-08-15 01:13:19 | 1 |
|
pET His6 ProteinG TEV LIC cloning vector (2P-T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29713 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2P-T has a TEV-cleavable N-terminal His6-Protein G fusion tag. Protein G can improve the expression and solubility of your target protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4975; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:20 | 2 | ||||
|
pET His6 Thioredoxin TEV LIC cloning vector (2T-T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29712 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2T-T has a TEV-cleavable N-terminal His6-thioredoxin fusion tag. Thioredoxin can improve the solubility of your target protein by promoting correct disulfide bond formation. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5131; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:23 | 1 | ||||
|
pET His6 Mocr TEV LIC cloning vector (2O-T) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29710 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2O-T has a TEV-cleavable N-terminal His6-Mocr fusion tag. Mocr can improve the expression and solubility of your target protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5908; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:20 | 6 | ||||
|
426Gal-FUS-RRM Mutant-YFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_29608 | FUS RRM mutant | Homo sapiens | Ampicillin | PMID:21541367 | Backbone Marker:Susan Lindquist (Addgene plasmid # 14227); Backbone Size:8126; Vector Backbone:pAG426Gal-ccdB-EYFP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | F305L, F341L, F359L and F368L | 2026-08-15 01:13:21 | 1 | |
|
pET His6 MBP prescission LIC cloning vector (HMPKS) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29721 | None | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a SLIC cloning protocol. Prescission is a highly specific protease that cleaves LEVLFQ/GP. It is generally more active than TEV protease, and many users have found that when their protein inhibits TEV cleavage, switching to a prescission vector has proved worthwhile. To clone into this vector, add SLIC tags to the 5' end of your PCR primers. Forward - 5'GTGCTGTTCCAGGGTCCGAAT3' Reverse - 5'TGGTGGTGGTGGTGCTCGA(TTA)3' Linearize the plasmid with SspI and XhoI, then gel purify. There is a 1650 bp stuffer sequence that will be visible on a gel. When digesting the DNA with T4 polymerase, use no nucleotides for either your insert or the linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:8106; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:23 | 4 | |||
|
pET His6 Sumo TEV LIC cloning vector (1S) Resource Report Resource Website 10+ mentions |
RRID:Addgene_29659 | None | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable His6 fusion tag on its N-terminus. Sumo can enhance the expression and solubility of your protein of interest. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/macrolab/ | Backbone Size:5661; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:20 | 36 | |||
|
pET His6 Mocr TEV LIC cloning vector (1O) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29658 | None | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable His6 fusion tag on its N-terminus. Mocr can enhance the expression and solubility of your protein of interest. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5712; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:22 | 1 | |||
|
pET His6 MBP TEV LIC cloning vector (1M) Resource Report Resource Website 10+ mentions |
RRID:Addgene_29656 | None | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable His6 fusion tag on its N-terminus. MBP can enhance your protein's solubility and expression. It can also be used as an affinity tag. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6465; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:20 | 48 | |||
|
pET His6 GST TEV LIC cloning vector (1G) Resource Report Resource Website 10+ mentions |
RRID:Addgene_29655 | None | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable His6 fusion tag on its N-terminus. GST can be used to enhance your protein's expression and solubility. It can also be used as an affinity tag. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6015; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:22 | 15 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.