Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: None
Vector Backbone Description: Backbone Size:5343; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29653 Copy
Genetic Insert: no insert
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2830; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: Sequence verified, no further characterization.
Proper citation: RRID:Addgene_29650 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5908; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2M-T has a TEV-cleavable N-terminal His6-MBP fusion tag. MBP can improve the expression and solubility of your target protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29708 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5458; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2G-T has a TEV-cleavable N-terminal His6-GST fusion tag. GST can improve the expression and solubility of your target protein.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29707 Copy
Vector Backbone Description: Backbone Size:5950; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2C-T has a TEV-cleavable N-terminal His6-MBP fusion tag. MBP can improve the expression and solubility of your target protein. The N10 linker may help you to avoid steric clashes between your protein and the MBP tag.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29706 Copy
Species: Mus musculus
Genetic Insert: 1.6 kB VEGF
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5598; Vector Backbone:PGL2 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8632007
Proper citation: RRID:Addgene_29667 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5352; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable Strep II fusion tag on its N-terminus.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/macrolab/
Proper citation: RRID:Addgene_29664 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:6075; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. GFP can enhance your protein's expression and solubility. It can also be used as a reporter gene.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/macrolab/
Proper citation: RRID:Addgene_29663 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5532; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. Protein G can enhance the expression and solubility of your protein of interest.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29660 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4470; Vector Backbone:pDONR201; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18248826
Comments: This plasmid contains a selectable marker for U. maydis transformation and was constructed by inserting a ~2.3 kb EcoICRI carboxin
resistance (cbxR) conferring fragment from pGR3 (kindly provided by J. Hargreaves) into the blunt ended NspI site of pDONR201.
Proper citation: RRID:Addgene_29634 Copy
Species: E.coli
Genetic Insert: BirA
Vector Backbone Description: Backbone Size:8683; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: The BirA gene was amplified from the E.coli TOP10F' strain, sequence confirmed, and functionally tested in E.coli using a protein fused to an AviTag.
Proper citation: RRID:Addgene_29649 Copy
Genetic Insert: BirA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2266; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: The BirA gene was amplified from the E.coli TOP10F' strain, sequence confirmed, and functionally tested in E.coli using a protein fused to an AviTag.
Please note that using this plasmid in a LR reaction with a Destination vector encoding an N-terminal tag is not recommended as it would not be in frame with the BirA sequence. This plasmid was designed to be used to biotinylate substrates in vivo. To add a tag to BirA, clone the desired tag into the vector itself, rather than using Gateway cloning--this approach will also prevent unnecessary sequence in the expressed protein.
Proper citation: RRID:Addgene_29645 Copy
Species: Homo sapiens
Genetic Insert: FUS
Vector Backbone Description: Backbone Marker:Susan Lindquist (Addgene plasmid # 14133); Backbone Size:6843; Vector Backbone:pAG303Gal-ccdB; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21541367
Proper citation: RRID:Addgene_29614 Copy
Species: Photinus pyralis
Genetic Insert: Firefly Luciferase
Vector Backbone Description: Backbone Size:7534; Vector Backbone:pTH645-RLuc; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21558172
Proper citation: RRID:Addgene_29698 Copy
Species: Homo sapiens
Genetic Insert: FUS
Vector Backbone Description: Backbone Size:0; Vector Backbone:pDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21541367
Proper citation: RRID:Addgene_29629 Copy
Species: Homo sapiens
Genetic Insert: FUS
Vector Backbone Description: Backbone Marker:Susan Lindquist (Addgene plasmid # 14219); Backbone Size:8004; Vector Backbone:pAG416Gal-ccdB-EYFP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21541367
Proper citation: RRID:Addgene_29628 Copy
Species: E. coli
Genetic Insert: LacZ-5BoxB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21423168
Proper citation: RRID:Addgene_29729 Copy
Vector Backbone Description: Backbone Size:6088; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
GFP has a excitation max of 489 nm and an emission max of 510 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29725 Copy
Vector Backbone Description: Backbone Size:6082; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
mOrange has a excitation max of 548 nm and an emission max of 562 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29723 Copy
Species: H. strain TP009
Genetic Insert: ArchT-tdTomato
Vector Backbone Description: Backbone Marker:Scott Sternson; Backbone Size:6259; Vector Backbone:AAV with CAG promoter; Vector Types:Mammalian Expression, AAV, Adeno-associated virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21811444
Comments: PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.
Proper citation: RRID:Addgene_29778 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
