Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pET His6 TEV LIC cloning vector (1B) Resource Report Resource Website 50+ mentions |
RRID:Addgene_29653 | None | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable His6 fusion tag on its N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5343; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:20 | 67 | |||
|
pENTR4-CLIPf (w877-2) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29650 | no insert | Kanamycin | Sequence verified, no further characterization. | Backbone Marker:Invitrogen; Backbone Size:2830; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:22 | 1 | |||
|
pET His6 MBP TEV LIC cloning vector (2M-T) Resource Report Resource Website 10+ mentions |
RRID:Addgene_29708 | None | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2M-T has a TEV-cleavable N-terminal His6-MBP fusion tag. MBP can improve the expression and solubility of your target protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5908; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:22 | 28 | |||
|
pET His6 GST TEV LIC cloning vector (2G-T) Resource Report Resource Website 10+ mentions |
RRID:Addgene_29707 | None | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2G-T has a TEV-cleavable N-terminal His6-GST fusion tag. GST can improve the expression and solubility of your target protein. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5458; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:20 | 19 | |||
|
pET His6 MBP N10 TEV LIC cloning vector (2C-T) Resource Report Resource Website 10+ mentions |
RRID:Addgene_29706 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2C-T has a TEV-cleavable N-terminal His6-MBP fusion tag. MBP can improve the expression and solubility of your target protein. The N10 linker may help you to avoid steric clashes between your protein and the MBP tag. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5950; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:23 | 16 | ||||
|
1.6 kB VEGF-luc Resource Report Resource Website 1+ mentions |
RRID:Addgene_29667 | 1.6 kB VEGF | Mus musculus | Ampicillin | PMID:8632007 | Backbone Marker:Promega; Backbone Size:5598; Vector Backbone:PGL2 Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:22 | 2 | ||
|
pET StrepII TEV LIC cloning vector (1R) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29664 | None | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable Strep II fusion tag on its N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/macrolab/ | Backbone Size:5352; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:22 | 8 | |||
|
pET His6 GFP TEV LIC cloning vector (1GFP) Resource Report Resource Website 10+ mentions |
RRID:Addgene_29663 | None | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable His6 fusion tag on its N-terminus. GFP can enhance your protein's expression and solubility. It can also be used as a reporter gene. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/macrolab/ | Backbone Size:6075; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:22 | 35 | |||
|
pET His6 ProteinG TEV LIC cloning vector (1P) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29660 | None | Kanamycin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable His6 fusion tag on its N-terminus. Protein G can enhance the expression and solubility of your protein of interest. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5532; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:22 | 1 | |||
|
pDONRCBX Resource Report Resource Website 1+ mentions |
RRID:Addgene_29634 | Kanamycin | PMID:18248826 | This plasmid contains a selectable marker for U. maydis transformation and was constructed by inserting a ~2.3 kb EcoICRI carboxin resistance (cbxR) conferring fragment from pGR3 (kindly provided by J. Hargreaves) into the blunt ended NspI site of pDONR201. | Backbone Marker:Invitrogen; Backbone Size:4470; Vector Backbone:pDONR201; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:22 | 2 | |||
|
pLenti PGK BirA Hygro (w874-1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29649 | BirA | E.coli | Ampicillin | The BirA gene was amplified from the E.coli TOP10F' strain, sequence confirmed, and functionally tested in E.coli using a protein fused to an AviTag. | Backbone Size:8683; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:20 | 2 | ||
|
BirA in pENTR1A (w860-1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29645 | BirA | Kanamycin | The BirA gene was amplified from the E.coli TOP10F' strain, sequence confirmed, and functionally tested in E.coli using a protein fused to an AviTag. Please note that using this plasmid in a LR reaction with a Destination vector encoding an N-terminal tag is not recommended as it would not be in frame with the BirA sequence. This plasmid was designed to be used to biotinylate substrates in vivo. To add a tag to BirA, clone the desired tag into the vector itself, rather than using Gateway cloning--this approach will also prevent unnecessary sequence in the expressed protein. | Backbone Marker:Invitrogen; Backbone Size:2266; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:22 | 1 | |||
|
303Gal-FUS Resource Report Resource Website 1+ mentions |
RRID:Addgene_29614 | FUS | Homo sapiens | Ampicillin | PMID:21541367 | Backbone Marker:Susan Lindquist (Addgene plasmid # 14133); Backbone Size:6843; Vector Backbone:pAG303Gal-ccdB; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:19 | 1 | ||
|
pTH652-RLuc/maxFLuc Resource Report Resource Website 1+ mentions |
RRID:Addgene_29698 | Firefly Luciferase | Photinus pyralis | Ampicillin | PMID:21558172 | Backbone Size:7534; Vector Backbone:pTH645-RLuc; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | All codons of the original FLuc gene were exchanged for those isoaccepting codons decoded by the most abundant tRNAs in yeast | 2026-08-15 01:13:20 | 1 | |
|
GST-TEV-FUS Resource Report Resource Website 1+ mentions |
RRID:Addgene_29629 | FUS | Homo sapiens | Ampicillin | PMID:21541367 | Backbone Size:0; Vector Backbone:pDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:21 | 5 | ||
|
416Gal-FUS-P525L-YFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_29628 | FUS | Homo sapiens | Ampicillin | PMID:21541367 | Backbone Marker:Susan Lindquist (Addgene plasmid # 14219); Backbone Size:8004; Vector Backbone:pAG416Gal-ccdB-EYFP; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | P525L | 2026-08-15 01:13:19 | 2 | |
|
LacZ-5BoxB in pcDNA3.1+ Resource Report Resource Website 1+ mentions |
RRID:Addgene_29729 | LacZ-5BoxB | E. coli | Ampicillin | PMID:21423168 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:20 | 2 | ||
|
pET Biotin His6 GFP LIC cloning vector (H6-msfGFP) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29725 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. GFP has a excitation max of 489 nm and an emission max of 510 nm. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6088; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:20 | 5 | ||||
|
pET Biotin His6 mOrange LIC cloning vector (H6-mOrange) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29723 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. mOrange has a excitation max of 548 nm and an emission max of 562 nm. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6082; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:23 | 1 | ||||
|
pAAV-CAG-ArchT-tdTomato Resource Report Resource Website 1+ mentions |
RRID:Addgene_29778 | ArchT-tdTomato | H. strain TP009 | Ampicillin | PMID:21811444 | PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE. | Backbone Marker:Scott Sternson; Backbone Size:6259; Vector Backbone:AAV with CAG promoter; Vector Types:Mammalian Expression, AAV, Adeno-associated virus; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:13:23 | 7 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
