Plasmids   Select Another Resource Report Type

http://www.addgene.org/29777

Species: H. strain TP009
Genetic Insert: ArchT-GFP
Vector Backbone Description: Backbone Marker:Scott Sternson; Backbone Size:5451; Vector Backbone:AAV with CAG promoter; Vector Types:Mammalian Expression, AAV, Adeno-associated virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21811444
Comments: PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.

Proper citation: RRID:Addgene_29777 Copy   

•   Source: Addgene

http://www.addgene.org/29772

Genetic Insert: None
Vector Backbone Description: Backbone Size:5481; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired. GFP has a excitation max of 489 nm and an emission max of 510 nm. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5' TTTAAGAAGGAGATATAGATC3' Reverse - 5' GTTGGAGGATGAGAGGATCCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with EcoRV, then gel purify. When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_29772 Copy   

•   Source: Addgene

http://www.addgene.org/29771

Vector Backbone Description: Backbone Size:5481; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired. mCitrine has a excitation max of 515 nm and an emission max of 529 nm. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5' TTTAAGAAGGAGATATAGATC3' Reverse - 5' GTTGGAGGATGAGAGGATCCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with EcoRV, then gel purify. When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_29771 Copy   

•   Source: Addgene

http://www.addgene.org/29780

Genetic Insert: shSCR
Vector Backbone Description: Backbone Size:9471; Vector Backbone:PLKO (modified); Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21109473
Comments: Sequence for scrambled sh is: aattctccgaacgtgtcacgtctcgagacgtgacacgttcggagaattttttt

Proper citation: RRID:Addgene_29780 Copy   

•   Source: Addgene

http://www.addgene.org/29766

Genetic Insert: let-7 sponge
Vector Backbone Description: Backbone Size:6000; Vector Backbone:MSCV puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18308936
Comments: The let-7 family sponge contains six bulged sites with alternating sequences AACUAUACAAGGACUACCUCA and AACUAUACAAUGACUACCUCA. The binding sites are for a consensus sequence of all mammalian let-7 miRNAs

Proper citation: RRID:Addgene_29766 Copy   

•   Source: Addgene

http://www.addgene.org/29747

Vector Backbone Description: Backbone Size:7270; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. mCherry has a excitation max of 587 nm and an emission max of 610 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_29747 Copy   

•   Source: Addgene

http://www.addgene.org/30141

Species: Homo sapiens
Genetic Insert: Amyloid Precursor Like Protein 1
Vector Backbone Description: Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654

Proper citation: RRID:Addgene_30141 Copy   

•   Source: Addgene

http://www.addgene.org/30147

Species: Homo sapiens
Genetic Insert: Amyloid Precursor Protein - soluble
Vector Backbone Description: Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18160654

Proper citation: RRID:Addgene_30147 Copy   

•   Source: Addgene

http://www.addgene.org/30121

Vector Backbone Description: Backbone Size:5279; Vector Backbone:pFastBac Dual; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is a LIC-adapted pFastBac Dual vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector is a dual expression vector, and your 2 genes can be inserted in any order (check your gene for internal restriction sites, as this may dictate cloning order). LIC site v1: Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize vector with SspI and gel purify. T4-treat vector with dGTP. For the PCR product, T4-treat with dCTP. LIC site v2 LicV2 Forward Tag TTTAAGAAGGAGATATAGATC(ATG) LicV2 Reverse Tag TTATGGAGTTGGGATCTTATTA Linearize vector with EcoRV and gel purify. T4-treat vector with dCTP. For the PCR product, T4-treat with dGTP. To sequence LIC site v1, use the following primers: LicBac dual V1 F cctataactattccggattattcataccgtc LicBac dual V1 R caggttcagggggaggtgtg To sequence LIC site v2, use the following primers: LicBac dual V2 F gtcatagcgcgggttccttcc LicBac dual V2 R ggagtatacggacctttaattcaaccc For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_30121 Copy   

•   Source: Addgene

http://www.addgene.org/30127

Vector Backbone Description: Backbone Size:6145; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is an empty LIC vector derived from pcDNA3. It adds a GFP gene to the C-terminus of your protein of interest. GFP has a excitation max of 489 nm and an emission max of 510 nm. To clone into this vector, add the following tags to your PCR primers: LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG) LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC Do NOT include a stop codon with your reverse primer. T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_30127 Copy   

•   Source: Addgene

http://www.addgene.org/30129

Species: Mus musculus
Genetic Insert: NeuroD1
Vector Backbone Description: Backbone Size:8373; Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20107439

Proper citation: RRID:Addgene_30129 Copy   

•   Source: Addgene

http://www.addgene.org/30128

Vector Backbone Description: Backbone Size:6145; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This is an empty LIC vector derived from pcDNA3. It adds an mCerulean gene to the C-terminus of your protein of interest. mCerulean has a excitation max of 435 nm and an emission max of 477 nm. To clone into this vector, add the following tags to your PCR primers: LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG) LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC Do NOT include a stop codon with your reverse primer. T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_30128 Copy   

•   Source: Addgene

http://www.addgene.org/30111

Vector Backbone Description: Backbone Size:4816; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. For more information, please see our website: http://qb3.berkeley.edu/macrolab/

Proper citation: RRID:Addgene_30111 Copy   

•   Source: Addgene

http://www.addgene.org/30113

Species: Homo sapiens
Genetic Insert: WASP-GBD
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5006; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10950951

Proper citation: RRID:Addgene_30113 Copy   

•   Source: Addgene

http://www.addgene.org/30116

Vector Backbone Description: Backbone Size:5976; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector will add a His6-MBP-N10-TEV sequence to the N terminus of your protein. MBP may improve the solubility of your protein. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_30116 Copy   

•   Source: Addgene

http://www.addgene.org/30115

Vector Backbone Description: Backbone Size:4812; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector will add a His6-TEV sequence to the N terminus of your protein. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_30115 Copy   

•   Source: Addgene

http://www.addgene.org/30184

Vector Backbone Description: Backbone Size:5380; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5' TACTTCCAATCCAATGCA3' Reverse - 5' CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_30184 Copy   

•   Source: Addgene

http://www.addgene.org/30187

Species: Mus musculus
Genetic Insert: MK2
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:3200; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_30187 Copy   

•   Source: Addgene

http://www.addgene.org/30182

Species: M. marinum
Genetic Insert: Mycobacterium Strong Promoter (MSP)
Vector Backbone Description: Backbone Marker:Ramakrishnan et al., 2000; Backbone Size:4981; Vector Backbone:pFPV27; Vector Types:Mycobacteria expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:23680983
Comments: This plasmid was derived from pMSP12::GFP by interrupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance. The GFP was then replaced with tdTomato. The tdTomato ORF is present at bp# 102-1532.

Proper citation: RRID:Addgene_30182 Copy   

•   Source: Addgene

http://www.addgene.org/30226

Species: Homo sapiens
Genetic Insert: rhVitronectin with N and C terminus cleavages
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4607; Vector Backbone:pET-3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21478862
Comments: Note that the first 19 amino acids are the signal peptide for VTN, which is cleaved off on the mature protein during normally protein synthesis in mammalian cells. That means wild type mature VTN starts from aa20. None of the four constructs from this paper have amino acids 1-19.

Proper citation: RRID:Addgene_30226 Copy   

•   Source: Addgene