Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAAV-CAG-ArchT-GFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_29777 | ArchT-GFP | H. strain TP009 | Ampicillin | PMID:21811444 | PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE. | Backbone Marker:Scott Sternson; Backbone Size:5451; Vector Backbone:AAV with CAG promoter; Vector Types:Mammalian Expression, AAV, Adeno-associated virus; Bacterial Resistance:Ampicillin | N/A | 2026-08-15 01:13:21 | 24 |
|
pET GFP LIC cloning vector (u-msfGFP) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29772 | None | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired. GFP has a excitation max of 489 nm and an emission max of 510 nm. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5' TTTAAGAAGGAGATATAGATC3' Reverse - 5' GTTGGAGGATGAGAGGATCCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with EcoRV, then gel purify. When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5481; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:23 | 6 | |||
|
pET mCitrine LIC cloning vector (u-mCitrine) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29771 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired. mCitrine has a excitation max of 515 nm and an emission max of 529 nm. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5' TTTAAGAAGGAGATATAGATC3' Reverse - 5' GTTGGAGGATGAGAGGATCCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with EcoRV, then gel purify. When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5481; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:21 | 3 | ||||
|
PLKO-mcherry-luc-puro-shSCR Resource Report Resource Website 1+ mentions |
RRID:Addgene_29780 | shSCR | Ampicillin | PMID:21109473 | Sequence for scrambled sh is: aattctccgaacgtgtcacgtctcgagacgtgacacgttcggagaattttttt | Backbone Size:9471; Vector Backbone:PLKO (modified); Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:21 | 2 | ||
|
MSCV puro let-7 sponge Resource Report Resource Website 1+ mentions |
RRID:Addgene_29766 | let-7 sponge | Ampicillin | PMID:18308936 | The let-7 family sponge contains six bulged sites with alternating sequences AACUAUACAAGGACUACCUCA and AACUAUACAAUGACUACCUCA. The binding sites are for a consensus sequence of all mammalian let-7 miRNAs | Backbone Size:6000; Vector Backbone:MSCV puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:23 | 8 | ||
|
pET MBP mCherry LIC cloning vector (MBP-mCherry) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29747 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. mCherry has a excitation max of 587 nm and an emission max of 610 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:7270; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:23 | 1 | ||||
|
pCAX APLP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_30141 | Amyloid Precursor Like Protein 1 | Homo sapiens | Ampicillin | PMID:18160654 | Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:25 | 2 | ||
|
pCAX APPs-695-alpha Resource Report Resource Website 1+ mentions |
RRID:Addgene_30147 | Amyloid Precursor Protein - soluble | Homo sapiens | Ampicillin | PMID:18160654 | Backbone Size:1380; Vector Backbone:pCAX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | amino acids 1–612 | 2026-08-15 01:13:25 | 3 | |
|
pFastBac Dual LIC cloning vector (5A) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30121 | Ampicillin | This plasmid is a LIC-adapted pFastBac Dual vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector is a dual expression vector, and your 2 genes can be inserted in any order (check your gene for internal restriction sites, as this may dictate cloning order). LIC site v1: Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize vector with SspI and gel purify. T4-treat vector with dGTP. For the PCR product, T4-treat with dCTP. LIC site v2 LicV2 Forward Tag TTTAAGAAGGAGATATAGATC(ATG) LicV2 Reverse Tag TTATGGAGTTGGGATCTTATTA Linearize vector with EcoRV and gel purify. T4-treat vector with dCTP. For the PCR product, T4-treat with dGTP. To sequence LIC site v1, use the following primers: LicBac dual V1 F cctataactattccggattattcataccgtc LicBac dual V1 R caggttcagggggaggtgtg To sequence LIC site v2, use the following primers: LicBac dual V2 F gtcatagcgcgggttccttcc LicBac dual V2 R ggagtatacggacctttaattcaaccc For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5279; Vector Backbone:pFastBac Dual; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:25 | 1 | ||||
|
pcDNA3 GFP LIC cloning vector (6D) Resource Report Resource Website 10+ mentions |
RRID:Addgene_30127 | Ampicillin | This is an empty LIC vector derived from pcDNA3. It adds a GFP gene to the C-terminus of your protein of interest. GFP has a excitation max of 489 nm and an emission max of 510 nm. To clone into this vector, add the following tags to your PCR primers: LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG) LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC Do NOT include a stop codon with your reverse primer. T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6145; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:25 | 12 | ||||
|
Tet-O-FUW-Neurod1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_30129 | NeuroD1 | Mus musculus | Ampicillin | PMID:20107439 | Backbone Size:8373; Vector Backbone:Tet-O-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:25 | 3 | ||
|
pcDNA3 mCerulean LIC cloning vector (6E) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30128 | Ampicillin | This is an empty LIC vector derived from pcDNA3. It adds an mCerulean gene to the C-terminus of your protein of interest. mCerulean has a excitation max of 435 nm and an emission max of 477 nm. To clone into this vector, add the following tags to your PCR primers: LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG) LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC Do NOT include a stop codon with your reverse primer. T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6145; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:22 | 1 | ||||
|
pFastBac LIC cloning vector (4A) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30111 | Ampicillin | This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. For more information, please see our website: http://qb3.berkeley.edu/macrolab/ | Backbone Size:4816; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:25 | 3 | ||||
|
pGEX-KG-WASP-GBD Resource Report Resource Website 1+ mentions |
RRID:Addgene_30113 | WASP-GBD | Homo sapiens | Ampicillin | PMID:10950951 | Backbone Marker:ATCC; Backbone Size:5006; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Contains the Cdc42-interacting domain of WASP (aaresidues 228-298), called WASP-GBD (for GTPase-binding domain) | 2026-08-15 01:13:25 | 1 | |
|
pFastBac His6 MBP N10 TEV LIC cloning vector (4C) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30116 | Ampicillin | This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector will add a His6-MBP-N10-TEV sequence to the N terminus of your protein. MBP may improve the solubility of your protein. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5976; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:22 | 8 | ||||
|
pFastBac His6 TEV LIC cloning vector (4B) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30115 | Ampicillin | This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector will add a His6-TEV sequence to the N terminus of your protein. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:4812; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:25 | 8 | ||||
|
pET Biotin His6 FlAsH LIC cloning vector (H6-FlAsH) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30184 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5' TACTTCCAATCCAATGCA3' Reverse - 5' CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5380; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:25 | 2 | ||||
|
pGEX-MK2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_30187 | MK2 | Mus musculus | Ampicillin | Backbone Marker:Amersham; Backbone Size:3200; Vector Backbone:pGEX-KG; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:23 | 1 | |||
|
pTEC27 Resource Report Resource Website 10+ mentions |
RRID:Addgene_30182 | Mycobacterium Strong Promoter (MSP) | M. marinum | Hygromycin | PMID:23680983 | This plasmid was derived from pMSP12::GFP by interrupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance. The GFP was then replaced with tdTomato. The tdTomato ORF is present at bp# 102-1532. | Backbone Marker:Ramakrishnan et al., 2000; Backbone Size:4981; Vector Backbone:pFPV27; Vector Types:Mycobacteria expression; Bacterial Resistance:Hygromycin | 2026-08-15 01:13:26 | 32 | |
|
pET-3c-rhVTN-NC Resource Report Resource Website 1+ mentions |
RRID:Addgene_30226 | rhVitronectin with N and C terminus cleavages | Homo sapiens | Ampicillin | PMID:21478862 | Note that the first 19 amino acids are the signal peptide for VTN, which is cleaved off on the mature protein during normally protein synthesis in mammalian cells. That means wild type mature VTN starts from aa20. None of the four constructs from this paper have amino acids 1-19. | Backbone Marker:Novagen; Backbone Size:4607; Vector Backbone:pET-3c; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | deleted amino acids: 399-478, 20-62 | 2026-08-15 01:13:26 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
