Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 33 showing 641 ~ 660 out of 69,553 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_41633

http://www.addgene.org/41633

Species: Homo sapiens
Genetic Insert: Transmembrane Protein 216
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22282472
Comments: See Table S6 of Supporting Online Material from associated publication for TMEM216 reference sequence.

Proper citation: RRID:Addgene_41633 Copy   

http://www.addgene.org/41590

Species: Homo sapiens
Genetic Insert: hsDicer
Vector Backbone Description: Backbone Size:4790; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22546613

Proper citation: RRID:Addgene_41590 Copy   

    • RRID:Addgene_41589

    This resource has 1+ mentions.

http://www.addgene.org/41589

Species: Homo sapiens
Genetic Insert: hsDicer
Vector Backbone Description: Backbone Size:4790; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22546613

Proper citation: RRID:Addgene_41589 Copy   

    • RRID:Addgene_41587

    This resource has 1+ mentions.

http://www.addgene.org/41587

Species: Homo sapiens
Genetic Insert: hsDicer
Vector Backbone Description: Backbone Size:4790; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22546613

Proper citation: RRID:Addgene_41587 Copy   

    • RRID:Addgene_41586

    This resource has 1+ mentions.

http://www.addgene.org/41586

Species: Homo sapiens
Genetic Insert: hsDicer
Vector Backbone Description: Backbone Size:4790; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22546613

Proper citation: RRID:Addgene_41586 Copy   

    • RRID:Addgene_41584

    This resource has 10+ mentions.

http://www.addgene.org/41584

Species: Homo sapiens
Genetic Insert: hsDicer
Vector Backbone Description: Backbone Size:4790; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22546613

Proper citation: RRID:Addgene_41584 Copy   

    • RRID:Addgene_41580

http://www.addgene.org/41580

Species: Homo sapiens
Genetic Insert: PKD1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21518865

Proper citation: RRID:Addgene_41580 Copy   

    • RRID:Addgene_41579

http://www.addgene.org/41579

Species: Homo sapiens
Genetic Insert: PKD1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21518865

Proper citation: RRID:Addgene_41579 Copy   

    • RRID:Addgene_41619

http://www.addgene.org/41619

Species: Homo sapiens
Genetic Insert: hPXR-LBD-T248E
Vector Backbone Description: Backbone Marker:ATCC (Item #77476); Backbone Size:5900; Vector Backbone:pSH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Human PXR ligand binding domain (LBD, aa 107-434) was cloned into vector pSH. Mutations were made and confirmed by sequencing.

Proper citation: RRID:Addgene_41619 Copy   

    • RRID:Addgene_41575

http://www.addgene.org/41575

Species: Homo sapiens
Genetic Insert: PKD1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5100; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21518865
Comments: 5' cloning site: EcoR1 3' cloning site: XhoI

Proper citation: RRID:Addgene_41575 Copy   

    • RRID:Addgene_41686

http://www.addgene.org/41686

Species: Homo sapiens
Genetic Insert: Dronpa145N-IntersectinDH-Dronpa145N-CAAX
Vector Backbone Description: Backbone Size:5370; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23139335

Proper citation: RRID:Addgene_41686 Copy   

    • RRID:Addgene_41840

    This resource has 1+ mentions.

http://www.addgene.org/41840

Species: Homo sapiens
Genetic Insert: apoptosis-associated speck-like protein containing CARD
Vector Backbone Description: Backbone Size:7332; Vector Backbone:pRP_LmCerulean; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23852599

Proper citation: RRID:Addgene_41840 Copy   

    • RRID:Addgene_41705

http://www.addgene.org/41705

Species: Homo sapiens
Genetic Insert: Crkl
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Constructed by Ron de Jong.

Proper citation: RRID:Addgene_41705 Copy   

http://www.addgene.org/41704

Species: Homo sapiens
Genetic Insert: Crkl
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Constructed by Ron de Jong.

Proper citation: RRID:Addgene_41704 Copy   

    • RRID:Addgene_41823

http://www.addgene.org/41823

Species: Homo sapiens
Genetic Insert: gRNA_DNMT3b
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23287722
Comments: gRNA target sequence GAATTACTCACGCCCCAAGG

Proper citation: RRID:Addgene_41823 Copy   

    • RRID:Addgene_41814

    This resource has 50+ mentions.

http://www.addgene.org/41814

Species: Homo sapiens
Genetic Insert: SOX2, KLF4
Vector Backbone Description: Backbone Size:9364; Vector Backbone:pCE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23193063

Proper citation: RRID:Addgene_41814 Copy   

    • RRID:Addgene_41811

http://www.addgene.org/41811

Species: Homo sapiens
Genetic Insert: H9 Super-2
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pMalLP; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22446627
Comments: This is an e. coli periplasmic expression vector. H9 has the following mutations compared to wildtype IL-2: L80F, R81F, L85V, I86V, I92F

Proper citation: RRID:Addgene_41811 Copy   

    • RRID:Addgene_41807

http://www.addgene.org/41807

Species: Homo sapiens
Genetic Insert: IL2
Vector Backbone Description: Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22446627

Proper citation: RRID:Addgene_41807 Copy   

    • RRID:Addgene_41806

http://www.addgene.org/41806

Species: Homo sapiens
Genetic Insert: IL2
Vector Backbone Description: Backbone Marker:BD; Backbone Size:9761; Vector Backbone:pAcGP67a; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22446627

Proper citation: RRID:Addgene_41806 Copy   

    • RRID:Addgene_41742

    This resource has 1+ mentions.

http://www.addgene.org/41742

Species: Homo sapiens
Genetic Insert: Halotag 2
Vector Backbone Description: Backbone Marker:INVITROGEN; Backbone Size:5000; Vector Backbone:PCDNA5; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21725302
Comments: Alternate plasmid name: pCDNA5-KGH2

Proper citation: RRID:Addgene_41742 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch