Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 33 showing 641 ~ 660 out of 328,630 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/46172

Species: Gallus gallus
Genetic Insert: Vcl 1-851
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15728584
Comments: Using in-frame primers containing 5′-NdeI and 3′-XhoI sites, appropriate regions of the chicken vinculin cDNA sequence were amplified by PCR followed by addition of 3′-adenosine overhangs with Taq polymerase. The PCR products were ligated into the TOPO II plasmid (Invitrogen) and then subcloned into pET15b His tag expression vector (Novagen, Madison, WI) using NdeI and XhoI digestion of the multiple cloning site.

Proper citation: RRID:Addgene_46172 Copy   


http://www.addgene.org/46173

Species: Gallus gallus
Genetic Insert: Vcl 1-258
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15728584
Comments: Using in-frame primers containing 5′-NdeI and 3′-XhoI sites, appropriate regions of the chicken vinculin cDNA sequence were amplified by PCR followed by addition of 3′-adenosine overhangs with Taq polymerase. The PCR products were ligated into the TOPO II plasmid (Invitrogen) and then subcloned into pET15b His tag expression vector (Novagen, Madison, WI) using NdeI and XhoI digestion of the multiple cloning site.

Proper citation: RRID:Addgene_46173 Copy   


http://www.addgene.org/46176

Species: Gallus gallus
Genetic Insert: Vcl 884-1066
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10373448
Comments: Using in-frame primers containing 5′-NdeI and 3′-XhoI sites, appropriate regions of the chicken vinculin cDNA sequence were amplified by PCR followed by addition of 3′-adenosine overhangs with Taq polymerase. The PCR products were ligated into the TOPO II plasmid (Invitrogen) and then subcloned into pET15b His tag expression vector (Novagen, Madison, WI) using NdeI and XhoI digestion of the multiple cloning site.

Proper citation: RRID:Addgene_46176 Copy   


  • RRID:Addgene_46331

    This resource has 1+ mentions.

http://www.addgene.org/46331

Species: Homo sapiens
Genetic Insert: Seh1
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23723238

Proper citation: RRID:Addgene_46331 Copy   


http://www.addgene.org/46174

Species: Gallus gallus
Genetic Insert: Vcl 1-851 A50I
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16608855
Comments: See Addgene plasmid 46172 for wild-type cloning information. The A50I mutation was introduced by QuikChange mutagenesis (Stratagene).

Proper citation: RRID:Addgene_46174 Copy   


  • RRID:Addgene_46295

    This resource has 10+ mentions.

http://www.addgene.org/46295

Species: Homo sapiens
Genetic Insert: PSD95.FingR-eGFP-CCR5TC
Vector Backbone Description: Backbone Size:4113; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23791193

Proper citation: RRID:Addgene_46295 Copy   


http://www.addgene.org/46175

Species: Gallus gallus
Genetic Insert: Vcl 1-258 A50I
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16608855
Comments: See Addgene plasmid 46173 for wild-type cloning information. The A50I mutation was introduced by QuikChange mutagenesis (Stratagene).

Proper citation: RRID:Addgene_46175 Copy   


  • RRID:Addgene_46296

    This resource has 10+ mentions.

http://www.addgene.org/46296

Species: Homo sapiens
Genetic Insert: GPHN.FingR-eGFP-CCR5TC
Vector Backbone Description: Backbone Size:4113; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23791193

Proper citation: RRID:Addgene_46296 Copy   


  • RRID:Addgene_46321

http://www.addgene.org/46321

Species: Homo sapiens
Genetic Insert: PSPC1
Vector Backbone Description: Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22966205
Comments: There is a stop codon before HIS tag in the vector.

Proper citation: RRID:Addgene_46321 Copy   


  • RRID:Addgene_46327

    This resource has 1+ mentions.

http://www.addgene.org/46327

Species: Homo sapiens
Genetic Insert: Depdc5
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23723238

Proper citation: RRID:Addgene_46327 Copy   


  • RRID:Addgene_46320

    This resource has 1+ mentions.

http://www.addgene.org/46320

Species: Homo sapiens
Genetic Insert: SFPQ
Vector Backbone Description: Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22966205
Comments: There is a stop codon before HIS tag in the vector.

Proper citation: RRID:Addgene_46320 Copy   


http://www.addgene.org/46284

Species: Gallus gallus
Genetic Insert: Vcl 1-1066
Vector Backbone Description: Backbone Marker:described in N. Kioka. 1999. JCB 144:59-69; Vector Backbone:p401F; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_46284 Copy   


  • RRID:Addgene_46318

http://www.addgene.org/46318

Genetic Insert: 5 copies of A9 sequence from Ihh promoter
Vector Backbone Description: Backbone Marker:Yang lab; Vector Backbone:Luc reporter vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19906842
Comments: Five copies of the WT A9 (GATCCAAAGGGAATGTTGCC) were inserted upstream of the TATA box (a 16 bp sequence) from the mouse osteocalcin gene 2 promoter (OG2-TATA box), which is followed by the Luc gene.

Proper citation: RRID:Addgene_46318 Copy   


http://www.addgene.org/46312

Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073
Comments: IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290

Proper citation: RRID:Addgene_46312 Copy   


http://www.addgene.org/46310

Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073
Comments: IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290

Proper citation: RRID:Addgene_46310 Copy   


http://www.addgene.org/46314

Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073
Comments: IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290

Proper citation: RRID:Addgene_46314 Copy   


  • RRID:Addgene_46315

    This resource has 1+ mentions.

http://www.addgene.org/46315

Species: Mus musculus
Genetic Insert: Vimentin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19726676

Proper citation: RRID:Addgene_46315 Copy   


  • RRID:Addgene_46300

http://www.addgene.org/46300

Species: Danio rerio
Genetic Insert: Brevican mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20525357
Comments: Please note that Addgene's sequencing results contain a few nucleotide mismatches when compared to the sequence provided by the depositing laboratory. These mismatches do not affect the production of recombinant antibodies, nor the affinity of the antibody for its antigen.

Proper citation: RRID:Addgene_46300 Copy   


  • RRID:Addgene_46305

http://www.addgene.org/46305

Species: Danio rerio
Genetic Insert: CD276 mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20525357

Proper citation: RRID:Addgene_46305 Copy   


  • RRID:Addgene_46306

    This resource has 1+ mentions.

http://www.addgene.org/46306

Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073

Proper citation: RRID:Addgene_46306 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X