Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5153; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT
Proper citation: RRID:Addgene_25753 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5309; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE
Proper citation: RRID:Addgene_25750 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA (TGCTCATGTATTCCCACGACAA) and co-expressed GFP
Proper citation: RRID:Addgene_25766 Copy
Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 12 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
Addgene sequence shows that this plasmid is missing the EcoRI and SpeI sites.
Proper citation: RRID:Addgene_25761 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; Human U6 promoter; 27nt U6 leader sequence expressed in transcript; Entry vector backbone; +ccdB in parent;
Addgene sequence shows that there is a T missing in U6 promoter sequence. Depositor is aware of the mismatch and it should not affect plasmid function.
Proper citation: RRID:Addgene_25747 Copy
Genetic Insert: cI of phage lambda, hok of the R1 plasmid, aacC4
Vector Backbone Description: Vector Backbone:pMW118; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35920321
Proper citation: RRID:Addgene_176229 Copy
Species: Synthetic
Genetic Insert: sfGFP pOGG037, T-pharma pOGG003 assembled in pOGG024
Vector Backbone Description: Vector Backbone:pOGG024; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:30692983
Comments: Please visit https://www.biorxiv.org/content/early/2018/08/16/392423 for bioRxiv preprint.
Proper citation: RRID:Addgene_115508 Copy
Species: Synthetic
Genetic Insert: sgRNA-B1
Vector Backbone Description: Vector Backbone:pSEVA631; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin
Comments: Please also refer to Pujar et al. 2024 Nucleic Acids Res. (https://doi.org/10.1093/nar/gkae1256, and see https://doi.org/10.1101/2024.09.02.610857 for bioRxiv preprint) for additional work using this plasmid.
Proper citation: RRID:Addgene_231422 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VIP1
Vector Backbone Description: Vector Backbone:pBB3; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:39966396
Proper citation: RRID:Addgene_238322 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VIP1
Vector Backbone Description: Vector Backbone:pBB3; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:39966396
Proper citation: RRID:Addgene_238320 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VIP1
Vector Backbone Description: Vector Backbone:pBB3; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:39966396
Proper citation: RRID:Addgene_238329 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VIP1
Vector Backbone Description: Vector Backbone:pBB3; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:39966396
Proper citation: RRID:Addgene_238318 Copy
Genetic Insert: AzFRS
Vector Backbone Description: Backbone Marker:Standard European Vector Architecture; Vector Backbone:pSEVA621; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:36287825
Proper citation: RRID:Addgene_242002 Copy
Species: Synthetic
Genetic Insert: Kva1 RT,Kva1 ncRNA, PaRecT and PaSSB
Vector Backbone Description: Backbone Marker:George Church (Addgene #138474); Vector Backbone:pORTMAGE-Pa1; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:42026131
Comments: Please visit https://doi.org/10.1101/2025.06.16.660010 for bioRxiv preprint.
Proper citation: RRID:Addgene_240703 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VIP1
Vector Backbone Description: Vector Backbone:pBB3; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:39966396
Proper citation: RRID:Addgene_238324 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VIP1
Vector Backbone Description: Vector Backbone:pBB3; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:39966396
Proper citation: RRID:Addgene_238327 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VIP1
Vector Backbone Description: Vector Backbone:pBB3; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:39966396
Proper citation: RRID:Addgene_238313 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: VIP1
Vector Backbone Description: Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:39966396
Proper citation: RRID:Addgene_238314 Copy
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:30178299
Proper citation: RRID:Addgene_109181 Copy
Species: Homo sapiens
Genetic Insert: SNF5
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pGS-BacA-21222, derived from pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:30178299
Proper citation: RRID:Addgene_109186 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
