Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: clec14aE1basEgfp
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pDESTtol2pACrymCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28723572
Proper citation: RRID:Addgene_90140 Copy
Species: Danio rerio
Genetic Insert: dopamine transporter
Vector Backbone Description: Vector Backbone:modified pGEM vector with Tol2 arms; Vector Types:zebrafish transgenesis; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21932324
Comments: Contains the dat genomic sequences, including approximately 13 kb of its 50-flanking region, but excluding the last coding exon and 30-flanking region. The EGFP coding sequence is cloned in frame into dat exon 1.
Due to large size, transformation and DNA prep efficiencies may be low. Electroporation is recommended for transformation and low copy prep protocols using large starting volumes are recommended for purifying the DNA.
Proper citation: RRID:Addgene_85418 Copy
Species: Danio rerio
Genetic Insert: Rab40b
Vector Backbone Description: Vector Backbone:pGemT easy; Vector Types:in situ probe/other; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_86228 Copy
Species: Danio rerio
Genetic Insert: Rab8a
Vector Backbone Description: Vector Backbone:pGemT easy; Vector Types:in situ probe/other; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_86221 Copy
Species: Danio rerio
Genetic Insert: Rab26
Vector Backbone Description: Vector Backbone:pGemT easy; Vector Types:in situ probe/other; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_86224 Copy
Species: Danio rerio
Genetic Insert: Rab35a
Vector Backbone Description: Vector Backbone:pGemT easy; Vector Types:in situ probe/other; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_86225 Copy
Species: Danio rerio
Genetic Insert: Rab1aa
Vector Backbone Description: Vector Backbone:pGemT easy; Vector Types:in situ probe/other; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_86217 Copy
Species: Danio rerio
Genetic Insert: GESTALT lineage tracing target V7
Vector Backbone Description: Backbone Size:12262; Vector Backbone:Tol2; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27229144
Comments: GESTALT V7 barcode for integration into zebrafish using the Tol2 system
Proper citation: RRID:Addgene_78627 Copy
Species: Danio rerio
Genetic Insert: kdrl promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2600; Vector Backbone:pDONRp4p1r; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17306248
Proper citation: RRID:Addgene_78687 Copy
Species: Danio rerio
Genetic Insert: acta2 promoter
Vector Backbone Description: Backbone Marker:Koichi Kawakami/ Chi-Bin Chien; Backbone Size:2417; Vector Backbone:pDestTol pA2; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24594685
Proper citation: RRID:Addgene_78684 Copy
Species: Danio rerio
Genetic Insert: acta2 promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2600; Vector Backbone:pDONRp4p1r; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24594685
Comments: The entire intron 1 was inserted upstream of 300 bp of proximal acta2 promoter to make a compact promoter/enhancer construct that could easily be used for transgenesis.
Proper citation: RRID:Addgene_78686 Copy
Species: Danio rerio
Genetic Insert: acta2
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17474123
Comments: Primers used to amplify cDNA:
CCCAGCACTGTCAGGTGATT and CCCATTCCTACCATCACTCC
acta2 promoter = A 300 bp proximal promoter for acta2 and 2165 bp fragment from the acta2 intron 1. The two genomic fragments were fused in a PCR reaction to make a 2465 bp enhancer/promoter construct
Acta2 3'UTR is in reverse orientation with t1440del, t1454c and a1578g compared to reference sequence. Depositor states that these discrepancies do not affect plasmid function.
Proper citation: RRID:Addgene_78711 Copy
Species: Danio rerio
Genetic Insert: Cerulean protein fused to zebrafish Rpl10a ribosomal unit
Vector Backbone Description: Backbone Size:6084; Vector Backbone:pMT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_79880 Copy
Species: Danio rerio
Genetic Insert: HA-tagged BirA, 2A, mCherry protein and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
Vector Backbone Description: Backbone Size:2994; Vector Backbone:pGEM-T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_79887 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Backbone Size:6903; Vector Backbone:pMT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_79886 Copy
Species: Danio rerio
Genetic Insert: Cerulean protein fused to zebrafish Rpl10a ribosomal unit
Vector Backbone Description: Vector Backbone:pMT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_79882 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Backbone Size:6903; Vector Backbone:pMT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_79885 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Vector Backbone:pMT; Vector Types:Bacterial Expression, zebrafish biotagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_80059 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Vector Backbone:pMT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_80058 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Backbone Size:5450; Vector Backbone:pMT; Vector Types:Bacterial Expression, zebrafish biotagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_80065 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
