Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pET15b/GgVcl V1-851 (aka Vh) Resource Report Resource Website |
RRID:Addgene_46172 | Vcl 1-851 | Gallus gallus | Ampicillin | PMID:15728584 | Using in-frame primers containing 5′-NdeI and 3′-XhoI sites, appropriate regions of the chicken vinculin cDNA sequence were amplified by PCR followed by addition of 3′-adenosine overhangs with Taq polymerase. The PCR products were ligated into the TOPO II plasmid (Invitrogen) and then subcloned into pET15b His tag expression vector (Novagen, Madison, WI) using NdeI and XhoI digestion of the multiple cloning site. | Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 1-851 (aka Vh) head domain | 2026-08-15 01:15:30 | 0 |
|
pET15b/GgVcl V1-258 (aka VD1) Resource Report Resource Website |
RRID:Addgene_46173 | Vcl 1-258 | Gallus gallus | Ampicillin | PMID:15728584 | Using in-frame primers containing 5′-NdeI and 3′-XhoI sites, appropriate regions of the chicken vinculin cDNA sequence were amplified by PCR followed by addition of 3′-adenosine overhangs with Taq polymerase. The PCR products were ligated into the TOPO II plasmid (Invitrogen) and then subcloned into pET15b His tag expression vector (Novagen, Madison, WI) using NdeI and XhoI digestion of the multiple cloning site. | Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 1-258 (VD1) | 2026-08-15 01:15:29 | 0 |
|
pET15b/GgVcl 884-1066 (aka Vt) Resource Report Resource Website |
RRID:Addgene_46176 | Vcl 884-1066 | Gallus gallus | Ampicillin | PMID:10373448 | Using in-frame primers containing 5′-NdeI and 3′-XhoI sites, appropriate regions of the chicken vinculin cDNA sequence were amplified by PCR followed by addition of 3′-adenosine overhangs with Taq polymerase. The PCR products were ligated into the TOPO II plasmid (Invitrogen) and then subcloned into pET15b His tag expression vector (Novagen, Madison, WI) using NdeI and XhoI digestion of the multiple cloning site. | Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 884-1066 (tail domain) | 2026-08-15 01:15:29 | 0 |
|
HA Seh1L pRK5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46331 | Seh1 | Homo sapiens | Ampicillin | PMID:23723238 | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:31 | 2 | ||
|
pET15b/GgVcl 1-851 A50I mutation Resource Report Resource Website |
RRID:Addgene_46174 | Vcl 1-851 A50I | Gallus gallus | Ampicillin | PMID:16608855 | See Addgene plasmid 46172 for wild-type cloning information. The A50I mutation was introduced by QuikChange mutagenesis (Stratagene). | Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 1-851 A50I mutation (talin binding domain mutant in vinculin head domain) | 2026-08-15 01:15:29 | 0 |
|
pCAG_PSD95.FingR-eGFP-CCR5TC Resource Report Resource Website 10+ mentions |
RRID:Addgene_46295 | PSD95.FingR-eGFP-CCR5TC | Homo sapiens | Ampicillin | PMID:23791193 | Backbone Size:4113; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 35 | ||
|
pET15b/GgVcl 1-258 A50I mutation Resource Report Resource Website |
RRID:Addgene_46175 | Vcl 1-258 A50I | Gallus gallus | Ampicillin | PMID:16608855 | See Addgene plasmid 46173 for wild-type cloning information. The A50I mutation was introduced by QuikChange mutagenesis (Stratagene). | Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 1-258 (VD1) A50I mutation; talin binding deficient | 2026-08-15 01:15:30 | 0 |
|
pCAG_GPHN.FingR-eGFP-CCR5TC Resource Report Resource Website 10+ mentions |
RRID:Addgene_46296 | GPHN.FingR-eGFP-CCR5TC | Homo sapiens | Ampicillin | PMID:23791193 | Backbone Size:4113; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 22 | ||
|
pSCT-GAL93-PSPC1 Resource Report Resource Website |
RRID:Addgene_46321 | PSPC1 | Homo sapiens | Ampicillin | PMID:22966205 | There is a stop codon before HIS tag in the vector. | Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | |
|
HA Depdc5 pRK5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46327 | Depdc5 | Homo sapiens | Ampicillin | PMID:23723238 | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Differs from Depdc5 isoform 1 by 10 amino acids starting at position 724: ILTLSAPPVV | 2026-08-15 01:15:30 | 3 | |
|
pSCT-GAL93-SFPQ Resource Report Resource Website 1+ mentions |
RRID:Addgene_46320 | SFPQ | Homo sapiens | Ampicillin | PMID:22966205 | There is a stop codon before HIS tag in the vector. | Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 1 | |
|
p401F/GgVcl 1-1066 (N term FLAG tag) Resource Report Resource Website |
RRID:Addgene_46284 | Vcl 1-1066 | Gallus gallus | Ampicillin | Backbone Marker:described in N. Kioka. 1999. JCB 144:59-69; Vector Backbone:p401F; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | |||
|
pIhh-5A9-LUC Resource Report Resource Website |
RRID:Addgene_46318 | 5 copies of A9 sequence from Ihh promoter | Ampicillin | PMID:19906842 | Five copies of the WT A9 (GATCCAAAGGGAATGTTGCC) were inserted upstream of the TATA box (a 16 bp sequence) from the mouse osteocalcin gene 2 promoter (OG2-TATA box), which is followed by the Luc gene. | Backbone Marker:Yang lab; Vector Backbone:Luc reporter vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | ||
|
pGEX-4T-1-p19-T7-PLK1 Resource Report Resource Website |
RRID:Addgene_46312 | p19 | Tomato bushy stunt virus | Ampicillin | PMID:23475073 | IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290 | Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | |
|
pGEX-4T-1-p19-T7-EGFPFL Resource Report Resource Website |
RRID:Addgene_46310 | p19 | Tomato bushy stunt virus | Ampicillin | PMID:23475073 | IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290 | Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | |
|
pGEX-4T-1-p19-T7-GagB500 Resource Report Resource Website |
RRID:Addgene_46314 | p19 | Tomato bushy stunt virus | Ampicillin | PMID:23475073 | IMPORTANT NOTE: Addgene was unable to sequence this plasmid to our usual standards of quality control due to the hairpin nature of the insert. More information about this plasmid can be found in a Dec. 2013 Nature Protocols paper from the Lieberman lab; PMID: 24177290 | Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | |
|
HA-Vim Resource Report Resource Website 1+ mentions |
RRID:Addgene_46315 | Vimentin | Mus musculus | Ampicillin | PMID:19726676 | Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 1 | ||
|
SI10-Brevican Resource Report Resource Website |
RRID:Addgene_46300 | Brevican mouse monoclonal antibody | Danio rerio | Ampicillin | PMID:20525357 | Please note that Addgene's sequencing results contain a few nucleotide mismatches when compared to the sequence provided by the depositing laboratory. These mismatches do not affect the production of recombinant antibodies, nor the affinity of the antibody for its antigen. | Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | |
|
SI15-CD276 Resource Report Resource Website |
RRID:Addgene_46305 | CD276 mouse monoclonal antibody | Danio rerio | Ampicillin | PMID:20525357 | Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 0 | ||
|
pGEX-4T-1-p19-T7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46306 | p19 | Tomato bushy stunt virus | Ampicillin | PMID:23475073 | Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin | 2026-08-15 01:15:30 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
