Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: G3_mTurquoise
Vector Backbone Description: Vector Backbone:pCR4Blunt-TOPO; Vector Types:Cloning/assembly plasmid; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31148366
Proper citation: RRID:Addgene_120783 Copy
Species: Synthetic
Genetic Insert: red fluorescent protein (mCherry), codon-optimized for C. difficile
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25527559
Proper citation: RRID:Addgene_120812 Copy
Species: Synthetic
Genetic Insert: red fluorescent protein (mCherry), codon-optimized for C. difficile, multiple-cloning site for protein fusion
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25527559
Proper citation: RRID:Addgene_120813 Copy
Species: Synthetic
Genetic Insert: cyan fluorescent protein, codon-optimized for low GC organisms
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24727226
Proper citation: RRID:Addgene_120814 Copy
Species: Synthetic
Genetic Insert: rsCaMPARI
Vector Backbone Description: Backbone Size:4270; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32931424
Proper citation: RRID:Addgene_120805 Copy
Species: Synthetic
Genetic Insert: Noncoding sequences for CRISPR-Cas12g1
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4327; Vector Backbone:pACYC184; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30523077
Comments: For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected].
Proper citation: RRID:Addgene_120880 Copy
Species: Synthetic
Genetic Insert: Cas12i1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5349; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30523077
Comments: For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC
Proper citation: RRID:Addgene_120882 Copy
Species: Synthetic
Genetic Insert: pcDNA3-fLuc=tdT
Vector Backbone Description: Backbone Size:5297; Vector Backbone:PB-CAG-eGFPd2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34650390
Proper citation: RRID:Addgene_120870 Copy
Species: Synthetic
Genetic Insert: moxMaple3
Vector Backbone Description: Vector Backbone:pBAD/His-D; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30283009
Proper citation: RRID:Addgene_120871 Copy
Species: Synthetic
Genetic Insert: Cas12c2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5355; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30523077
Comments: For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected]. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC
Proper citation: RRID:Addgene_120873 Copy
Species: Synthetic
Genetic Insert: Permuteposon P3
Vector Backbone Description: Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31128779
Comments: For detailed annotations of the modified R1R2 and R2R1 sites see the Genbank file under Resource Information/Supplemental Documents.
Proper citation: RRID:Addgene_120865 Copy
Species: Synthetic
Genetic Insert: Permuteposon P4
Vector Backbone Description: Vector Backbone:ColE1; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31128779
Comments: For detailed annotations of the modified R1R2 and R2R1 sites see the Genbank file under Resource Information/Supplemental Documents.
Proper citation: RRID:Addgene_120866 Copy
Species: Synthetic
Genetic Insert: pcDNA3-Antares2
Vector Backbone Description: Backbone Marker:SynBio-Tech; Backbone Size:5290; Vector Backbone:PB-CAG-eGFPd2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34650390
Proper citation: RRID:Addgene_120868 Copy
Species: Synthetic
Genetic Insert: Akaluc
Vector Backbone Description: Backbone Marker:ClonTech; Backbone Size:4023; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34650390
Proper citation: RRID:Addgene_120869 Copy
Species: Synthetic
Genetic Insert: J23101
Vector Backbone Description: Backbone Size:2100; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Comments: Please see Supplemental Documents for annotated Genbank file.
Proper citation: RRID:Addgene_120934 Copy
Species: Synthetic
Genetic Insert: ohAB carb pLasTetO
Vector Backbone Description: Backbone Size:2122; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_120938 Copy
Species: Synthetic
Genetic Insert: ccdA antitoxin
Vector Backbone Description: Backbone Size:2100; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_120991 Copy
Species: Synthetic
Genetic Insert: mfLon protease
Vector Backbone Description: Backbone Size:2100; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_120992 Copy
Species: Synthetic
Genetic Insert: CinR Adam Meyer
Vector Backbone Description: Backbone Size:2100; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Comments: Please see Supplemental Documents for annotated Genbank file.
Proper citation: RRID:Addgene_120983 Copy
Species: Synthetic
Genetic Insert: LacI Adam Meyer
Vector Backbone Description: Backbone Size:2100; Vector Backbone:DVA; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Comments: Please see Supplemental Documents for annotated Genbank file.
Proper citation: RRID:Addgene_120984 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.