Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: EEA1
Vector Backbone Description: Vector Backbone:pTwist Entr; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_214991 Copy
Species: Mus musculus
Genetic Insert: anti-Neuroligin-2 (Mus musculus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37758930
Comments: This is a recombinant antibody derived from RRID: AB_2916210. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_188184 Copy
Species: Mus musculus
Genetic Insert: CCGTATAGGCGGCTGCCCAA
Vector Backbone Description: Backbone Marker:NIDA GEVVC; Backbone Size:6400; Vector Backbone:pOTTC1553; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36798245
Proper citation: RRID:Addgene_195018 Copy
Species: Mus musculus
Genetic Insert: Zc3h12c
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5432; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38830770
Proper citation: RRID:Addgene_222655 Copy
Species: Mus musculus
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:11892; Vector Backbone:pRRL-Cas9-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36662885
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.10.20.465061v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_186892 Copy
Species: Mus musculus
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:11892; Vector Backbone:pRRL-Cas9-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36662885
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.10.20.465061v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_186890 Copy
Species: Mus musculus
Genetic Insert: Mouse cGAS truncation mutant (148-508 a.a.) with C-terminal GFP fusion
Vector Backbone Description: Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36662885
Comments: Contains Kozak sequence (gccacc) before start codon. Glycine-Serine linker is inserted between cGAS and GFP. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_186878 Copy
Species: Mus musculus
Genetic Insert: Mouse cGAS with C-terminal GFP fusion
Vector Backbone Description: Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36662885
Comments: Contains Kozak sequence (gccacc) before start codon. Glycine-Serine linker is inserted between cGAS and GFP. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_186877 Copy
Species: Mus musculus
Genetic Insert: Mouse cGAS truncation mutant (148-508 a.a.) with C-terminal HA tag
Vector Backbone Description: Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36662885
Comments: Contains Kozak sequence (gccacc) before start codon. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_186876 Copy
Species: Mus musculus
Genetic Insert: Mouse cGAS truncation mutant (145-508 a.a.) with C-terminal HA tag
Vector Backbone Description: Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36662885
Comments: Contains Kozak sequence (gccacc) before start codon. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_186895 Copy
Species: Mus musculus
Genetic Insert: tissue inhibitor of metalloproteinase 1
Vector Backbone Description: Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37851372
Proper citation: RRID:Addgene_186979 Copy
Species: Mus musculus
Genetic Insert: Zc3h12c 1-409 aa
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5432; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38830770
Proper citation: RRID:Addgene_222658 Copy
Species: Mus musculus
Genetic Insert: Zc3h12c 1-244 aa
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5432; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38830770
Proper citation: RRID:Addgene_222659 Copy
Species: Mus musculus
Genetic Insert: MyoD
Vector Backbone Description: Backbone Size:9591; Vector Backbone:pHR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_216666 Copy
Species: Mus musculus
Genetic Insert: NLRP3
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_218638 Copy
Species: Mus musculus
Genetic Insert: NLRP3
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_218640 Copy
Species: Mus musculus
Genetic Insert: Plekha3
Vector Backbone Description: Vector Backbone:LentiCRISPRv2-Opti (Addgene #163126); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_218649 Copy
Species: Mus musculus
Genetic Insert: Plekha3
Vector Backbone Description: Vector Backbone:LentiCRISPRv2-Opti (Addgene #163126); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_218648 Copy
Species: Mus musculus
Genetic Insert: NLRP3
Vector Backbone Description: Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_218641 Copy
Species: Mus musculus
Genetic Insert: Hook2
Vector Backbone Description: Vector Backbone:lentiCRISPRv2 mCherry; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_218653 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
