Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pTwist-msEEA1 Resource Report Resource Website |
RRID:Addgene_214991 | EEA1 | Mus musculus | Kanamycin | Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. | Vector Backbone:pTwist Entr; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:29:28 | 0 | ||
|
Anti-Neuroligin-2 [L107/95R] Resource Report Resource Website |
RRID:Addgene_188184 | anti-Neuroligin-2 (Mus musculus) recombinant mouse monoclonal antibody | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant antibody derived from RRID: AB_2916210. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:29:39 | 0 | |
|
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs Resource Report Resource Website |
RRID:Addgene_195018 | CCGTATAGGCGGCTGCCCAA | Mus musculus | Ampicillin | PMID:36798245 | Backbone Marker:NIDA GEVVC; Backbone Size:6400; Vector Backbone:pOTTC1553; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:29:40 | 0 | ||
|
pCDNA3-Regnase-3 WT Resource Report Resource Website |
RRID:Addgene_222655 | Zc3h12c | Mus musculus | Ampicillin | PMID:38830770 | Backbone Marker:Invitrogen; Backbone Size:5432; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:31:01 | 0 | ||
|
pRRL-mouse STING #1-gRNA-Cas9-Puro Resource Report Resource Website |
RRID:Addgene_186892 | Cas9 | Mus musculus | Ampicillin | PMID:36662885 | Please visit https://www.biorxiv.org/content/10.1101/2021.10.20.465061v2 for bioRxiv preprint. | Backbone Size:11892; Vector Backbone:pRRL-Cas9-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:31:03 | 0 | |
|
pRRL-mouse cGAS #1-gRNA-Cas9-Puro Resource Report Resource Website |
RRID:Addgene_186890 | Cas9 | Mus musculus | Ampicillin | PMID:36662885 | Please visit https://www.biorxiv.org/content/10.1101/2021.10.20.465061v2 for bioRxiv preprint. | Backbone Size:11892; Vector Backbone:pRRL-Cas9-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:31:03 | 0 | |
|
pTRE3G-mouse cGASdeltaN-GFP Resource Report Resource Website |
RRID:Addgene_186878 | Mouse cGAS truncation mutant (148-508 a.a.) with C-terminal GFP fusion | Mus musculus | Ampicillin | PMID:36662885 | Contains Kozak sequence (gccacc) before start codon. Glycine-Serine linker is inserted between cGAS and GFP. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint. | Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | N-terminal truncation | 2026-08-15 01:31:03 | 0 |
|
pTRE3G-mouse cGAS-GFP Resource Report Resource Website |
RRID:Addgene_186877 | Mouse cGAS with C-terminal GFP fusion | Mus musculus | Ampicillin | PMID:36662885 | Contains Kozak sequence (gccacc) before start codon. Glycine-Serine linker is inserted between cGAS and GFP. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint. | Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:31:03 | 0 | |
|
pTRE3G-mouse cGASdeltaN-HA Resource Report Resource Website |
RRID:Addgene_186876 | Mouse cGAS truncation mutant (148-508 a.a.) with C-terminal HA tag | Mus musculus | Ampicillin | PMID:36662885 | Contains Kozak sequence (gccacc) before start codon. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint. | Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | N-terminal truncation | 2026-08-15 01:31:03 | 0 |
|
pTRE3G-mouse cGAS:145-508aa-HA Resource Report Resource Website |
RRID:Addgene_186895 | Mouse cGAS truncation mutant (145-508 a.a.) with C-terminal HA tag | Mus musculus | Ampicillin | PMID:36662885 | Contains Kozak sequence (gccacc) before start codon. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint. | Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | N-terminal truncation | 2026-08-15 01:31:03 | 0 |
|
MSCV-TIMP1 Resource Report Resource Website |
RRID:Addgene_186979 | tissue inhibitor of metalloproteinase 1 | Mus musculus | Ampicillin | PMID:37851372 | Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:31:03 | 0 | ||
|
pCDNA3-FLAG-Regnase-3_1-409 aa Resource Report Resource Website |
RRID:Addgene_222658 | Zc3h12c 1-409 aa | Mus musculus | Ampicillin | PMID:38830770 | Backbone Marker:Invitrogen; Backbone Size:5432; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | mutated proline 410 to a stop codon | 2026-08-15 01:31:08 | 0 | |
|
pCDNA3-FLAG-Regnase-3_1-244 aa Resource Report Resource Website |
RRID:Addgene_222659 | Zc3h12c 1-244 aa | Mus musculus | Ampicillin | PMID:38830770 | Backbone Marker:Invitrogen; Backbone Size:5432; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | mutated asparagine 245 to a stop codon | 2026-08-15 01:31:08 | 0 | |
|
pHR-TRE-MyoD-P2A-miRFP703_PGK-Puro Resource Report Resource Website |
RRID:Addgene_216666 | MyoD | Mus musculus | Ampicillin | Backbone Size:9591; Vector Backbone:pHR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:31:16 | 0 | |||
|
pDONR221 msNLRP3 (STOP) Resource Report Resource Website |
RRID:Addgene_218638 | NLRP3 | Mus musculus | Kanamycin | Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. | Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:29:59 | 0 | ||
|
pDONR221 msNLRP3(ΔPYD, I125M-END) (STOP) Resource Report Resource Website |
RRID:Addgene_218640 | NLRP3 | Mus musculus | Kanamycin | Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. | Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | delPYD (I125M-END) | 2026-08-15 01:29:58 | 0 | |
|
msPlekha3 (msFapp1) g2 lentiCRISPRv2-opti Resource Report Resource Website |
RRID:Addgene_218649 | Plekha3 | Mus musculus | Ampicillin | Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. | Vector Backbone:LentiCRISPRv2-Opti (Addgene #163126); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:00 | 0 | ||
|
msPlekha3 (msFapp1) g1 lentiCRISPRv2-opti Resource Report Resource Website |
RRID:Addgene_218648 | Plekha3 | Mus musculus | Ampicillin | Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. | Vector Backbone:LentiCRISPRv2-Opti (Addgene #163126); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:29:58 | 0 | ||
|
pDONR221 msNLRP3(ΔPYD, I125M-END) Resource Report Resource Website |
RRID:Addgene_218641 | NLRP3 | Mus musculus | Kanamycin | Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. | Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | delPYD (I125M-END) | 2026-08-15 01:29:58 | 0 | |
|
msHook2 g2 lentiCRISPRv2-mCherry Resource Report Resource Website |
RRID:Addgene_218653 | Hook2 | Mus musculus | Ampicillin | Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. | Vector Backbone:lentiCRISPRv2 mCherry; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:30:00 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.