Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:mus musculus (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

12,972 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pTwist-msEEA1
 
Resource Report
Resource Website 		RRID:Addgene_214991 EEA1 Mus musculus Kanamycin Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. Vector Backbone:pTwist Entr; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:29:28 0
Anti-Neuroligin-2 [L107/95R]
 
Resource Report
Resource Website 		RRID:Addgene_188184 anti-Neuroligin-2 (Mus musculus) recombinant mouse monoclonal antibody Mus musculus Ampicillin PMID:37758930 This is a recombinant antibody derived from RRID: AB_2916210. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:29:39 0
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
 
Resource Report
Resource Website 		RRID:Addgene_195018 CCGTATAGGCGGCTGCCCAA Mus musculus Ampicillin PMID:36798245 Backbone Marker:NIDA GEVVC; Backbone Size:6400; Vector Backbone:pOTTC1553; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:29:40 0
pCDNA3-Regnase-3 WT
 
Resource Report
Resource Website 		RRID:Addgene_222655 Zc3h12c Mus musculus Ampicillin PMID:38830770 Backbone Marker:Invitrogen; Backbone Size:5432; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:31:01 0
pRRL-mouse STING #1-gRNA-Cas9-Puro
 
Resource Report
Resource Website 		RRID:Addgene_186892 Cas9 Mus musculus Ampicillin PMID:36662885 Please visit https://www.biorxiv.org/content/10.1101/2021.10.20.465061v2 for bioRxiv preprint. Backbone Size:11892; Vector Backbone:pRRL-Cas9-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:31:03 0
pRRL-mouse cGAS #1-gRNA-Cas9-Puro
 
Resource Report
Resource Website 		RRID:Addgene_186890 Cas9 Mus musculus Ampicillin PMID:36662885 Please visit https://www.biorxiv.org/content/10.1101/2021.10.20.465061v2 for bioRxiv preprint. Backbone Size:11892; Vector Backbone:pRRL-Cas9-Puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:31:03 0
pTRE3G-mouse cGASdeltaN-GFP
 
Resource Report
Resource Website 		RRID:Addgene_186878 Mouse cGAS truncation mutant (148-508 a.a.) with C-terminal GFP fusion Mus musculus Ampicillin PMID:36662885 Contains Kozak sequence (gccacc) before start codon. Glycine-Serine linker is inserted between cGAS and GFP. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint. Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin N-terminal truncation 2026-08-15 01:31:03 0
pTRE3G-mouse cGAS-GFP
 
Resource Report
Resource Website 		RRID:Addgene_186877 Mouse cGAS with C-terminal GFP fusion Mus musculus Ampicillin PMID:36662885 Contains Kozak sequence (gccacc) before start codon. Glycine-Serine linker is inserted between cGAS and GFP. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint. Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:31:03 0
pTRE3G-mouse cGASdeltaN-HA
 
Resource Report
Resource Website 		RRID:Addgene_186876 Mouse cGAS truncation mutant (148-508 a.a.) with C-terminal HA tag Mus musculus Ampicillin PMID:36662885 Contains Kozak sequence (gccacc) before start codon. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint. Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin N-terminal truncation 2026-08-15 01:31:03 0
pTRE3G-mouse cGAS:145-508aa-HA
 
Resource Report
Resource Website 		RRID:Addgene_186895 Mouse cGAS truncation mutant (145-508 a.a.) with C-terminal HA tag Mus musculus Ampicillin PMID:36662885 Contains Kozak sequence (gccacc) before start codon. Please visit https://www.biorxiv.org/content/10.1101/2022.03.09.483681v2 for bioRxiv preprint. Backbone Marker:Takara Bio; Backbone Size:6600; Vector Backbone:pRetroX-TRE3G Vector; Vector Types:Retroviral; Bacterial Resistance:Ampicillin N-terminal truncation 2026-08-15 01:31:03 0
MSCV-TIMP1
 
Resource Report
Resource Website 		RRID:Addgene_186979 tissue inhibitor of metalloproteinase 1 Mus musculus Ampicillin PMID:37851372 Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:31:03 0
pCDNA3-FLAG-Regnase-3_1-409 aa
 
Resource Report
Resource Website 		RRID:Addgene_222658 Zc3h12c 1-409 aa Mus musculus Ampicillin PMID:38830770 Backbone Marker:Invitrogen; Backbone Size:5432; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin mutated proline 410 to a stop codon 2026-08-15 01:31:08 0
pCDNA3-FLAG-Regnase-3_1-244 aa
 
Resource Report
Resource Website 		RRID:Addgene_222659 Zc3h12c 1-244 aa Mus musculus Ampicillin PMID:38830770 Backbone Marker:Invitrogen; Backbone Size:5432; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin mutated asparagine 245 to a stop codon 2026-08-15 01:31:08 0
pHR-TRE-MyoD-P2A-miRFP703_PGK-Puro
 
Resource Report
Resource Website 		RRID:Addgene_216666 MyoD Mus musculus Ampicillin Backbone Size:9591; Vector Backbone:pHR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:31:16 0
pDONR221 msNLRP3 (STOP)
 
Resource Report
Resource Website 		RRID:Addgene_218638 NLRP3 Mus musculus Kanamycin Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:29:59 0
pDONR221 msNLRP3(ΔPYD, I125M-END) (STOP)
 
Resource Report
Resource Website 		RRID:Addgene_218640 NLRP3 Mus musculus Kanamycin Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin delPYD (I125M-END) 2026-08-15 01:29:58 0
msPlekha3 (msFapp1) g2 lentiCRISPRv2-opti
 
Resource Report
Resource Website 		RRID:Addgene_218649 Plekha3 Mus musculus Ampicillin Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. Vector Backbone:LentiCRISPRv2-Opti (Addgene #163126); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:30:00 0
msPlekha3 (msFapp1) g1 lentiCRISPRv2-opti
 
Resource Report
Resource Website 		RRID:Addgene_218648 Plekha3 Mus musculus Ampicillin Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. Vector Backbone:LentiCRISPRv2-Opti (Addgene #163126); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:29:58 0
pDONR221 msNLRP3(ΔPYD, I125M-END)
 
Resource Report
Resource Website 		RRID:Addgene_218641 NLRP3 Mus musculus Kanamycin Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin delPYD (I125M-END) 2026-08-15 01:29:58 0
msHook2 g2 lentiCRISPRv2-mCherry
 
Resource Report
Resource Website 		RRID:Addgene_218653 Hook2 Mus musculus Ampicillin Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. Vector Backbone:lentiCRISPRv2 mCherry; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:30:00 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch