Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pcDNA3.1 Flag YFP hNKCC1 V729S (NT553)
 
Resource Report
Resource Website
RRID:Addgene_50911 human NKCC1 (synthetic) Homo sapiens Ampicillin Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin V729S in hNKCC1 in NT17 2026-08-15 01:16:10 0
pcDNA3.1 Flag YFP hNKCC1 N672C (NT474)
 
Resource Report
Resource Website
RRID:Addgene_50873 human NKCC1 (synthetic) Homo sapiens Ampicillin PMID:24451383 Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin N672C in hNKCC1 in NT17 2026-08-15 01:16:12 0
pcDNA3.1 Flag YFP hNKCC1 L671C (NT440)
 
Resource Report
Resource Website
RRID:Addgene_50872 human NKCC1 (synthetic) Homo sapiens Ampicillin Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin L671C in hNKCC1 in NT17 2026-08-15 01:16:09 0
pcDNA3.1 Flag YFP hNKCC1 I674C (NT475)
 
Resource Report
Resource Website
RRID:Addgene_50875 human NKCC1 (synthetic) Homo sapiens Ampicillin PMID:24451383 Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin I674C in hNKCC1 in NT17 2026-08-15 01:16:09 0
pHAGE EF1α dCas9-VP64
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_50918 dCas9 S. pyogenes Ampicillin PMID:24346702 Please note that there are several mismatches (minor deletions and insertions) between depositor's reference sequence and Addgene's quality control sequence. The mismatches are in cloning junctions/non-coding regions and should not affect plasmid function. Vector Backbone:pHAGE; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin D10A, H840A 2026-08-15 01:16:12 23
pcDNA3.1 Flag YFP hNKCC1 P676C I730C N-terminal deletion (NT96)
 
Resource Report
Resource Website
RRID:Addgene_50914 human NKCC1 (synthetic) Homo sapiens Ampicillin PMID:24451383 Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin P676C I730C N-term deletion of aa13-222 in hNKCC1 in NT17 2026-08-15 01:16:10 0
pHAGE TRE dCas9-VP64
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_50916 dCas9 S. pyogenes Ampicillin PMID:24346702 Please note that there are several mismatches (minor deletions and insertions) between depositor's reference sequence and Addgene's quality control sequence. The mismatches are in cloning junctions/non-coding regions and should not affect plasmid function. Vector Backbone:pHAGE; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin D10A, H840A nuclease-deficient 2026-08-15 01:16:10 11
pcDNA3.1 Flag YFP hNKCC1 S679C (NT447)
 
Resource Report
Resource Website
RRID:Addgene_50880 human NKCC1 (synthetic) Homo sapiens Ampicillin PMID:24451383 Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin S679C in hNKCC1 in NT17 2026-08-15 01:16:09 0
pcDNA3.1 Flag YFP hNKCC1 F728C (NT502)
 
Resource Report
Resource Website
RRID:Addgene_50882 human NKCC1 (synthetic) Homo sapiens Ampicillin Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin F728C in hNKCC1 in NT17 2026-08-15 01:16:12 0
pcDNA3.1 Flag YFP hNKCC1 N680C (NT468)
 
Resource Report
Resource Website
RRID:Addgene_50881 human NKCC1 (synthetic) Homo sapiens Ampicillin PMID:24451383 Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin N680C in hNKCC1 in NT17 2026-08-15 01:16:09 0
pcDNA3.1 Flag YFP hNKCC1 A734C (NT508)
 
Resource Report
Resource Website
RRID:Addgene_50888 human NKCC1 (synthetic) Homo sapiens Ampicillin Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin A734C in hNKCC1 in NT17 2026-08-15 01:16:12 0
pLKO.1-puro U6 sgRNA Oct4A -12
 
Resource Report
Resource Website
RRID:Addgene_50921 Oct4A -12 sgRNA Homo sapiens Ampicillin PMID:24346702 gRNA target sequence GTGGGACTGGGGAGGGAGAG Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:12 0
pLKO.1-puro U6 sgRNA SOX17 -91
 
Resource Report
Resource Website
RRID:Addgene_50923 Sox17 -91 sgRNA Homo sapiens Ampicillin PMID:24346702 gRNA target sequence GGGCGTGGGCCTAACGACGC Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pLKO.1-puro U6 sgRNA Oct4A -158
 
Resource Report
Resource Website
RRID:Addgene_50922 Oct4A -158 sgRNA Homo sapiens Ampicillin PMID:24346702 gRNA target sequence GGGGCGCCAGTTGTGTCTCC Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pcDNA3.1 Flag YFP hNKCC1 I730C (NT504)
 
Resource Report
Resource Website
RRID:Addgene_50884 human NKCC1 (synthetic) Homo sapiens Ampicillin PMID:24451383 Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin I730C in hNKCC1 in NT17 2026-08-15 01:16:09 0
pRGE31
 
Resource Report
Resource Website
RRID:Addgene_50929 Ampicillin PMID:23956122 Please use the reference links above to access a published protocol for using plasmids pRGE31, pRGEB31, pRGE32 and pRGEB32 as well as a CRISPR design software tool. Backbone Marker:Nakagawa,T.; Backbone Size:6034; Vector Backbone:pUGW11; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pLKO.1-puro U6 sgRNA SOX17 -177
 
Resource Report
Resource Website
RRID:Addgene_50925 Sox17 -177 sgRNA Homo sapiens Ampicillin PMID:24346702 gRNA target sequence GCTCCGGCTAGTTTTCCCGG Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pLKO.1-puro U6 sgRNA CAG
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_50927 negative control sgRNA synthetic Ampicillin PMID:24346702 Please note that Addgene's diagnostic digest results suggest that the backbone may be longer than suggested. Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:13 4
pLKO.1-puro U6 sgRNA SOX17 -296
 
Resource Report
Resource Website
RRID:Addgene_50926 Sox17-296 sgRNA Homo sapiens Ampicillin PMID:24346702 gRNA target sequence GGGCAAGTACGTCGATTCCA Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-15 01:16:10 0
pcDNA3.1 Flag YFP hNKCC1 Y739C (NT525)
 
Resource Report
Resource Website
RRID:Addgene_50893 human NKCC1 (synthetic) Homo sapiens Ampicillin Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct. Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Y739C in hNKCC1 in NT17 2026-08-15 01:16:09 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.