Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 332 showing 6621 ~ 6640 out of 740,017 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.addgene.org/50899

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_50899 Copy   

    • RRID:Addgene_50932

http://www.addgene.org/50932

Species: Homo sapiens
Genetic Insert: SRP14 and SRP9
Vector Backbone Description: Backbone Marker:Chang-Deng Hu (Addgene Plasmid# 22010); Backbone Size:5216; Vector Backbone:pBiFC-VN173; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50932 Copy   

    • RRID:Addgene_50934

http://www.addgene.org/50934

Species: Homo sapiens
Genetic Insert: scAluYNF1
Vector Backbone Description: Backbone Marker:Dewannieux,M., Esnault,C. and Heidmann,T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35, 41-4; Backbone Size:2773; Vector Backbone:pAlu-NeoTet; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25697503

Proper citation: RRID:Addgene_50934 Copy   

    • RRID:Addgene_50933

http://www.addgene.org/50933

Species: Homo sapiens
Genetic Insert: AluYNF1
Vector Backbone Description: Backbone Marker:Dewannieux,M., Esnault,C. and Heidmann,T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35, 41-4; Backbone Size:2773; Vector Backbone:pAlu-NeoTet; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25697503

Proper citation: RRID:Addgene_50933 Copy   

http://www.addgene.org/50894

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_50894 Copy   

http://www.addgene.org/50897

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_50897 Copy   

    • RRID:Addgene_50930

    This resource has 1+ mentions.

http://www.addgene.org/50930

Species: Homo sapiens
Genetic Insert: SRP14 and SRP9
Vector Backbone Description: Backbone Marker:Chang-Deng Hu (Addgene Plasmid# 22010); Backbone Size:5216; Vector Backbone:pBiFC-VN173; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50930 Copy   

http://www.addgene.org/50896

Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.

Proper citation: RRID:Addgene_50896 Copy   

    • RRID:Addgene_50939

    This resource has 1+ mentions.

http://www.addgene.org/50939

Species: Homo sapiens
Genetic Insert: PML-3
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10779416

Proper citation: RRID:Addgene_50939 Copy   

    • RRID:Addgene_50936

    This resource has 1+ mentions.

http://www.addgene.org/50936

Species: Homo sapiens
Genetic Insert: PTEN 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck-2; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22000013
Comments: Primers used to amplify the 3'UTR of PTEN: PTEN3′UTR-F TAGAGGAGCCGTCAAATCCA, PTEN3′UTR-R CCCCCACTTTAGTGCACAGT,

Proper citation: RRID:Addgene_50936 Copy   

    • RRID:Addgene_50941

    This resource has 1+ mentions.

http://www.addgene.org/50941

Species: Homo sapiens
Genetic Insert: RanGTPase activating protein 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5677; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22464730

Proper citation: RRID:Addgene_50941 Copy   

    • RRID:Addgene_50837

    This resource has 1+ mentions.

http://www.addgene.org/50837

Genetic Insert: PHAkt
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909100

Proper citation: RRID:Addgene_50837 Copy   

    • RRID:Addgene_50839

    This resource has 1+ mentions.

http://www.addgene.org/50839

Species: Arabidopsis thaliana
Genetic Insert: PhyB 1-908
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909100
Comments: Please note this plasmid is a crucial component of the system described in this additional reference: Toettcher JE, Weiner OD, Lim WA, Cell. 2013 Dec 5;155(6):1422-34. doi: 10.1016/j.cell.2013.11.004. (PMID 24315106)

Proper citation: RRID:Addgene_50839 Copy   

http://www.addgene.org/48083

Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX-Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848

Proper citation: RRID:Addgene_48083 Copy   

    • RRID:Addgene_48115

http://www.addgene.org/48115

Genetic Insert: promoter sacB - gfp
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17692983

Proper citation: RRID:Addgene_48115 Copy   

    • RRID:Addgene_48118

    This resource has 1+ mentions.

http://www.addgene.org/48118

Genetic Insert: signal peptide of YngK
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20435764

Proper citation: RRID:Addgene_48118 Copy   

    • RRID:Addgene_48119

http://www.addgene.org/48119

Genetic Insert: signal peptide of Vpr
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20435764

Proper citation: RRID:Addgene_48119 Copy   

    • RRID:Addgene_48198

http://www.addgene.org/48198

Species: Cylindrospermum licheniforme
Genetic Insert: CylA
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5293; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23106426

Proper citation: RRID:Addgene_48198 Copy   

http://www.addgene.org/48192

Species: Homo sapiens
Genetic Insert: Ataxin1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23512657

Proper citation: RRID:Addgene_48192 Copy   

    • RRID:Addgene_48193

http://www.addgene.org/48193

Species: Homo sapiens
Genetic Insert: Ataxin1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23512657

Proper citation: RRID:Addgene_48193 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch