Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: MSIIFFLPL
Vector Backbone Description: Backbone Size:8300; Vector Backbone:PresentER; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30499773
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/22/267047 for bioRxiv preprint.
Proper citation: RRID:Addgene_102946 Copy
Species: Mus musculus
Genetic Insert: shNfs1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Proper citation: RRID:Addgene_102967 Copy
Species: Mus musculus
Genetic Insert: PGC1a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1 myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10983978
Proper citation: RRID:Addgene_1030 Copy
Species: Mus musculus
Genetic Insert: PGC-1 beta
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA-flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11733490
Proper citation: RRID:Addgene_1031 Copy
Species: Mus musculus
Genetic Insert: Map2k1
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17574021
Proper citation: RRID:Addgene_15268 Copy
Species: Mus musculus
Genetic Insert: murine CD3 delta-gamma-epsilon-zeta subunits
Vector Backbone Description: Backbone Marker:Maki Nakayama; Vector Backbone:pMI-LO; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32328071
Comments: Second gene is LSSmOrange
Proper citation: RRID:Addgene_153418 Copy
Species: Mus musculus
Genetic Insert: murine TCR-alpha signal peptide and murine TCR-beta2 constant region (TRBC2)
Vector Backbone Description: Backbone Marker:Maki Nakayama; Vector Backbone:pMI-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34611019
Comments: Second gene is puromycin-resistant gene
Proper citation: RRID:Addgene_153420 Copy
Species: Mus musculus
Genetic Insert: Chr2-GFP-P2A-GFP
Vector Backbone Description: Vector Backbone:AAV-Dlx-GFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32807948
Comments: Please visit https://www.biorxiv.org/content/10.1101/808170v1 for BioRxiv preprint.
Proper citation: RRID:Addgene_153437 Copy
Species: Mus musculus
Genetic Insert: Chr2-GFP-P2A-GFP
Vector Backbone Description: Vector Backbone:AAV-Dlx-GFP; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32807948
Comments: Please visit https://www.biorxiv.org/content/10.1101/808170v1 for BioRxiv preprint.
Proper citation: RRID:Addgene_153434 Copy
Species: Mus musculus
Genetic Insert: short hairpin RNA against mouse Mi-2 beta
Vector Backbone Description: Backbone Marker:Smale Lab; Backbone Size:8290; Vector Backbone:pQsupR; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16452502
Comments: Target sequence: GACTACGACCTGTTCAAGCAG
Proper citation: RRID:Addgene_15379 Copy
Species: Mus musculus
Genetic Insert: mU6-BRG/BRM shRNA
Vector Backbone Description: Backbone Marker:Smale lab; Backbone Size:8017; Vector Backbone:pRVGP; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16452502
Comments: Mouse U6 promoter followed by short hairpin RNA against mouse BRG/BRM genes. Target sequence: TGGAGAAGCAGCAGAAGATT.
Proper citation: RRID:Addgene_15380 Copy
Species: Mus musculus
Genetic Insert: Upstream region of mouse Esg1 gene
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGV-BM2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16504174
Proper citation: RRID:Addgene_15394 Copy
Species: Mus musculus
Genetic Insert: Otx2
Vector Backbone Description: Backbone Size:7061; Vector Backbone:PiggyBac transposon; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31996670
Proper citation: RRID:Addgene_153947 Copy
Species: Mus musculus
Genetic Insert: CasRx, Ptbp1 sgRNAs
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32272060
Comments: INSERT 1: CasRx driven by GFAP promoter.
INSERT 2: DR-SgRNA_Ptbp1 driven by U6 promoter.
Ptbp1 gRNA 5: 5′-tgtagatgggctgtccacgaagcactggcg-3′
Ptbp1 gRNA 6: 5′-gcttggagaagtcgatgcgcagcgtgcagc-3′
Proper citation: RRID:Addgene_154001 Copy
Species: Mus musculus
Genetic Insert: MED9
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5900; Vector Backbone:pET41a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14638676
Proper citation: RRID:Addgene_15408 Copy
Species: Mus musculus
Genetic Insert: MED11
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14576168
Proper citation: RRID:Addgene_15414 Copy
Species: Mus musculus
Genetic Insert: PKA catalytic subunit alpha
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSET B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16214430
Proper citation: RRID:Addgene_14920 Copy
Species: Mus musculus
Genetic Insert: PKA catalytic subunit alpha
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5700; Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9109651
Proper citation: RRID:Addgene_14921 Copy
Species: Mus musculus
Genetic Insert: Tdg
Vector Backbone Description: Backbone Marker:Primo Schär Lab; Backbone Size:13769; Vector Backbone:pTCO2 (Addgene Plasmid #149428); Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936
Proper citation: RRID:Addgene_149429 Copy
Species: Mus musculus
Genetic Insert: Tdg
Vector Backbone Description: Backbone Marker:Primo Schär Lab; Backbone Size:13769; Vector Backbone:pTCO2 (Addgene Plasmid #149428); Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936
Proper citation: RRID:Addgene_149431 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
