Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 334 showing 6661 ~ 6680 out of 6,853 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/191729

Species: Other
Genetic Insert: mTFP1
Vector Backbone Description: Vector Backbone:rAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403704
Comments: Allen Institute plasmid ALIAS: AiP12965 This work supported by NIH BRAIN Initiative grant UF1MH128339

Proper citation: RRID:Addgene_191729 Copy   


http://www.addgene.org/191709

Species: Other
Genetic Insert: SYFP2
Vector Backbone Description: Vector Backbone:rAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403704
Comments: Allen Institute plasmid ALIAS: AiP12982 This work supported by NIH BRAIN Initiative grant UF1MH128339

Proper citation: RRID:Addgene_191709 Copy   


http://www.addgene.org/191706

Species: Other
Genetic Insert: SYFP2
Vector Backbone Description: Vector Backbone:rAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403704
Comments: Allen Institute plasmid ALIAS: AiP13044 This work supported by NIH BRAIN Initiative grant UF1MH128339

Proper citation: RRID:Addgene_191706 Copy   


  • RRID:Addgene_220446

http://www.addgene.org/220446

Species: Other
Genetic Insert: CfaN-Gal4-CfaC
Vector Backbone Description: Vector Backbone:pBS; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38602904
Comments: 5' Cloning Site: AgeI SphI NotI (unknown if destroyed), 3' Cloning Site: AscI KpnI SpeI (unknown if destroyed)

Proper citation: RRID:Addgene_220446 Copy   


  • RRID:Addgene_224215

http://www.addgene.org/224215

Species: Other
Genetic Insert: Fncpf1
Vector Backbone Description: Vector Backbone:pFW2000; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34995484

Proper citation: RRID:Addgene_224215 Copy   


  • RRID:Addgene_224436

http://www.addgene.org/224436

Species: other
Genetic Insert: H2B-mScarlet3
Vector Backbone Description: Vector Backbone:pCS2FA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36973546

Proper citation: RRID:Addgene_224436 Copy   


  • RRID:Addgene_225144

http://www.addgene.org/225144

Species: Other
Genetic Insert: MMLVgag-TadCBEd
Vector Backbone Description: Backbone Size:4756; Vector Backbone:pCDNA3-like; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38191664

Proper citation: RRID:Addgene_225144 Copy   


http://www.addgene.org/241912

Species: Other
Genetic Insert: QUAS enhancer driving mNeonGreen-NES and mKate2-NLS
Vector Backbone Description: Backbone Size:7839; Vector Backbone:pDestTol2CR; Vector Types:zebrafish Tol2 transgenesis; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41123438

Proper citation: RRID:Addgene_241912 Copy   


  • RRID:Addgene_241830

http://www.addgene.org/241830

Species: Other
Genetic Insert: CitA-Tq-LR
Vector Backbone Description: Vector Backbone:pRsetB; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41071660

Proper citation: RRID:Addgene_241830 Copy   


  • RRID:Addgene_234549

    This resource has 1+ mentions.

http://www.addgene.org/234549

Species: Other
Genetic Insert: Alb-mStayGold
Vector Backbone Description: Backbone Marker:VVF (p438) https://vvf.ethz.ch/ ; Vector Backbone:pAAV-P3 (Addgene plasmid #183460); Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41393514

Proper citation: RRID:Addgene_234549 Copy   


http://www.addgene.org/246982

Species: Other
Genetic Insert: φC31(PhiC31)
Vector Backbone Description: Backbone Marker:NA; Backbone Size:5218; Vector Backbone:pET28a(+)v2; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: We use a tag-free SUMO protease (ulp1) for cleaving the TwinStrep tag from the final product. Tag-free ulp1 can be synthesized using Addgene Plasmid #190063 and a His-tagged TEV protease or HRV-3C protease (PreScission protease). The total insert size displayed on this page (2403bp) includes all tags and linkers.

Proper citation: RRID:Addgene_246982 Copy   


  • RRID:Addgene_239940

http://www.addgene.org/239940

Species: Other
Genetic Insert: CaMV 35S::dCas9
Vector Backbone Description: Vector Backbone:Binary; Vector Types:Plant Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:38769424

Proper citation: RRID:Addgene_239940 Copy   


  • RRID:Addgene_239946

http://www.addgene.org/239946

Species: Other
Genetic Insert: CaMV 35S-SynPro-01::Rluc
Vector Backbone Description: Vector Backbone:pBluescript SK(+); Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38769424

Proper citation: RRID:Addgene_239946 Copy   


  • RRID:Addgene_235121

http://www.addgene.org/235121

Species: Other
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Defining Citation: PMID:42199375
Comments: Genotype: E. coli B F- ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS) ΔendA ΔrecA glvC ::[ phlFAM, cymRAM, luxR, vanRAM, lacIAM, tetR ] Fast growth at 37C in LB (doubling time ~ 20-25 minutes) and improved DNA (endA, recA) and protein stability (lon, ompT). Strain validation: - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 5 518 bp. - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1160(GCTTGTCGACGACGGC) generates a product of 140 bp. - PCR using OR1157 (TACCCCAGTTGGGGCAC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 110 bp. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.

Proper citation: RRID:Addgene_235121 Copy   


  • RRID:Addgene_239937

http://www.addgene.org/239937

Species: Other
Genetic Insert: CaMV 35S::dCas9
Vector Backbone Description: Vector Backbone:pBluescript SK(+); Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38769424

Proper citation: RRID:Addgene_239937 Copy   


  • RRID:Addgene_239887

http://www.addgene.org/239887

Species: Other
Genetic Insert: CaMV 35S::Rluc
Vector Backbone Description: Vector Backbone:pBluescript SK(+); Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38769424

Proper citation: RRID:Addgene_239887 Copy   


  • RRID:Addgene_239936

http://www.addgene.org/239936

Species: Other
Genetic Insert: Hsp18.2::sgRNA-B
Vector Backbone Description: Vector Backbone:pCK2; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38769424
Comments: Please note: This plasmid contains an IS4 transposable element inserted in the backbone. This insertion does not impact plasmid function.

Proper citation: RRID:Addgene_239936 Copy   


  • RRID:Addgene_241313

http://www.addgene.org/241313

Species: Other
Genetic Insert: mCherry fluorescent protein
Vector Backbone Description: Vector Backbone:pMAX; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_241313 Copy   


http://www.addgene.org/242971

Species: Other
Genetic Insert: mScarlet3-H
Vector Backbone Description: Vector Backbone:pTriEx-3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_242971 Copy   


http://www.addgene.org/242973

Species: Other
Genetic Insert: Giantin-mScarlet3-H
Vector Backbone Description: Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_242973 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X