Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
p5E-ESyn1 Resource Report Resource Website |
RRID:Addgene_80804 | p5E-ESyn1 | Kanamycin | PMID:27500400 | Backbone Marker:Invitrogen; Backbone Size:2623; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 0 | |||
|
pDonor-tBFP-NLS-Neo (Universal) Resource Report Resource Website 10+ mentions |
RRID:Addgene_80767 | PITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT) | Synthetic | Kanamycin | PMID:28179459 | Backbone Marker:Kazuhisa Nakayama Lab. (Addgene plasmid #80766); Backbone Size:4761; Vector Backbone:pDonor-tBFP-NLS-Neo; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 19 | ||
|
pENTR-SYNZIP16 Resource Report Resource Website |
RRID:Addgene_80670 | SYNZIP16 | Synthetic | Kanamycin | PMID:22558529 | Backbone Marker:Invitrogen; Backbone Size:2592; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 0 | ||
|
pENTR-SYNZIP22 Resource Report Resource Website |
RRID:Addgene_80676 | SYNZIP22 | Synthetic | Kanamycin | PMID:22558529 | Backbone Marker:Invitrogen; Backbone Size:2592; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 0 | ||
|
pET-IG-mSA Resource Report Resource Website 1+ mentions |
RRID:Addgene_80706 | Monomeric streptavidin | Synthetic | Kanamycin | PMID:26979420 | Backbone Marker:Homemade; Backbone Size:5300; Vector Backbone:pET-IG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 2 | ||
|
pENTR-SYNZIP7 Resource Report Resource Website |
RRID:Addgene_80663 | SYNZIP7 | Synthetic | Kanamycin | PMID:22558529 | Backbone Marker:Invitrogen; Backbone Size:2586; Vector Backbone:pENTR_D-TOPO; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:40 | 0 | ||
|
pCDB181 Resource Report Resource Website |
RRID:Addgene_80692 | gEHEE_06 | Synthetic | Kanamycin | PMID:27626386 | Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 0 | ||
|
pCDB289 Resource Report Resource Website |
RRID:Addgene_80690 | gEEHE_02 | Synthetic | Kanamycin | PMID:27626386 | Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 0 | ||
|
pCDB267 Resource Report Resource Website |
RRID:Addgene_80695 | gHHH_06 | Synthetic | Kanamycin | PMID:27626386 | Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 0 | ||
|
pCDB294 Resource Report Resource Website |
RRID:Addgene_80693 | gHEEE_02 | Synthetic | Kanamycin | PMID:27626386 | Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 0 | ||
|
pCDB185 Resource Report Resource Website |
RRID:Addgene_80688 | gEEH_04 | Synthetic | Kanamycin | PMID:27626386 | Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 0 | ||
|
pCDB285 Resource Report Resource Website |
RRID:Addgene_80687 | gEEEH_04 | Synthetic | Kanamycin | PMID:27626386 | Backbone Marker:custom made; Backbone Size:6155; Vector Backbone:pCDB180; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 0 | ||
|
p3E-P2A-mKate2 no-pA Resource Report Resource Website |
RRID:Addgene_80828 | p3E-P2A-mKate2 no pA | Other | Kanamycin | PMID:27500400 | Backbone Marker:Invitrogen; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:42 | 0 | ||
|
p3E-P2A-CFP no-pA Resource Report Resource Website |
RRID:Addgene_80827 | p3E-P2A-CFP no pA | Other | Kanamycin | PMID:27500400 | Backbone Marker:Invitrogen; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:42 | 0 | ||
|
p3E-P2A-GFP no-pA Resource Report Resource Website |
RRID:Addgene_80826 | p3E-P2A-GFP no-pA | Other | Kanamycin | PMID:27500400 | Backbone Marker:Invitrogen; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:42 | 0 | ||
|
p3E-P2A-MCS no-pA Resource Report Resource Website 1+ mentions |
RRID:Addgene_80825 | p3E-P2A-MCS no pA | Other | Kanamycin | PMID:27500400 | Backbone Marker:Invitrogen; Vector Backbone:pDONR P2R-P3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:41 | 2 | ||
|
pENTR221 UBR5 Resource Report Resource Website |
RRID:Addgene_81062 | Ubiquitin protein ligase E3 component N-recognin 5 (UBR5) | Homo sapiens | Kanamycin | PMID:29742019 | Addgene comment: Please note that the K503R mutation was present in the original source of UBR5 and is thought not to affect the overall function. Please see the comments section of Plasmid #37191 for more details. | Backbone Marker:Invitrogen; Backbone Size:2522; Vector Backbone:pDONR221; Vector Types:Cloning; Bacterial Resistance:Kanamycin | K503R | 2026-08-15 01:20:43 | 0 |
|
pENTR221 UBR5 ∆UBR Resource Report Resource Website |
RRID:Addgene_81063 | Ubiquitin protein ligase E3 component N-recognin 5 (UBR5) ∆UBR | Homo sapiens | Kanamycin | PMID:29742019 | Backbone Marker:Invitrogen; Backbone Size:2522; Vector Backbone:pDONR221; Vector Types:Cloning; Bacterial Resistance:Kanamycin | W1235L (bp g3704t) | 2026-08-15 01:20:43 | 0 | |
|
pENTR221 UBR5 ∆PABC Resource Report Resource Website |
RRID:Addgene_81064 | Ubiquitin protein ligase E3 component N-recognin 5 (UBR5) ∆PABC | Homo sapiens | Kanamycin | PMID:29742019 | Backbone Marker:Invitrogen; Backbone Size:2522; Vector Backbone:pDONR221; Vector Types:Cloning; Bacterial Resistance:Kanamycin | Y2402A and K2415A (bp t7204g, a7205c, t7206c, a7243g, a7244c and a7245c) | 2026-08-15 01:20:44 | 0 | |
|
const #7-RFP Resource Report Resource Website |
RRID:Addgene_81081 | RFP | Kanamycin | PMID:24142050 | Backbone Size:2099; Vector Backbone:pBbA0k-RFP; Vector Types:P15A origin, Constitutive promoter, kanR; Bacterial Resistance:Kanamycin | 2026-08-15 01:20:43 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.