Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Organism:other (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

6,853 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pDestTol2CR-QUAS:mNeonGreen-NES-P2A-mKate2-NLS
 
Resource Report
Resource Website
RRID:Addgene_241912 QUAS enhancer driving mNeonGreen-NES and mKate2-NLS Other Ampicillin PMID:41123438 Backbone Size:7839; Vector Backbone:pDestTol2CR; Vector Types:zebrafish Tol2 transgenesis; Bacterial Resistance:Ampicillin 2026-08-29 01:25:28 0
pRsetB-CitA-Tq-LR
 
Resource Report
Resource Website
RRID:Addgene_241830 CitA-Tq-LR Other Kanamycin PMID:41071660 Vector Backbone:pRsetB; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:25:27 0
pAAV-P3-Alb-mStayGold
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_234549 Alb-mStayGold Other Ampicillin PMID:41393514 Backbone Marker:VVF (p438) https://vvf.ethz.ch/ ; Vector Backbone:pAAV-P3 (Addgene plasmid #183460); Vector Types:AAV; Bacterial Resistance:Ampicillin None 2026-08-29 01:25:29 1
pET28a(+)v2_TwinStrep-SUMO-φC31(PhiC31)-8xHis
 
Resource Report
Resource Website
RRID:Addgene_246982 φC31(PhiC31) Other Kanamycin We use a tag-free SUMO protease (ulp1) for cleaving the TwinStrep tag from the final product. Tag-free ulp1 can be synthesized using Addgene Plasmid #190063 and a His-tagged TEV protease or HRV-3C protease (PreScission protease). The total insert size displayed on this page (2403bp) includes all tags and linkers. Backbone Marker:NA; Backbone Size:5218; Vector Backbone:pET28a(+)v2; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-29 01:25:29 0
pHnS 2comp KI;Nlgn2 #2
 
Resource Report
Resource Website
RRID:Addgene_240303 KI gRNA for Nlgn2 Other Ampicillin Vector Backbone:pHnS; Vector Types:AAV; Bacterial Resistance:Ampicillin NA 2026-08-29 01:25:04 0
LLP1021
 
Resource Report
Resource Website
RRID:Addgene_239943 Rluc Other Spectinomycin PMID:38769424 Vector Backbone:pAGM9121; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin N/A 2026-08-29 01:25:09 0
LLP1013
 
Resource Report
Resource Website
RRID:Addgene_239935 Csy4 recognition sequence Other Spectinomycin PMID:38769424 Vector Backbone:pAGM9121; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin N/A 2026-08-29 01:25:09 0
LLP1012
 
Resource Report
Resource Website
RRID:Addgene_239934 Csy4 Other Spectinomycin PMID:38769424 Vector Backbone:pAGM9121; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin N/A 2026-08-29 01:25:09 0
LLP1011
 
Resource Report
Resource Website
RRID:Addgene_239933 dCas9 Other Spectinomycin PMID:38769424 Vector Backbone:pAGM9121; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin N/A 2026-08-29 01:25:14 0
DH-BB[5'SIN;181/25ORF]
 
Resource Report
Resource Website
RRID:Addgene_242479 Chikungunya virus 181/25 strain structural proteins Other Ampicillin Please visit https://doi.org/10.1101/2025.06.25.661405 for bioRxiv preprint. Vector Backbone:pSIN; Vector Types:Sindbis virus helper construct; Bacterial Resistance:Ampicillin 2026-08-29 01:25:17 0
pVT-EGFP
 
Resource Report
Resource Website
RRID:Addgene_234917 EGFP Other Kanamycin PMID:40394900 Backbone Marker:Tuttle et al Plant Methods. 2012 Aug 1;8(1):27. doi: 10.1186/1746-4811-8-27.; Vector Backbone:pJRT.Agro.CLCrVA.008; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:24:17 0
pSLQ14107 fwYellow-targeting sgRNA
 
Resource Report
Resource Website
RRID:Addgene_239456 guide targeting fwYellow Other Ampicillin PMID:39095367 Vector Backbone:pUC19; Vector Types:Bacterial Expression, CRISPR, Cell-free system using bacterial extract; Bacterial Resistance:Ampicillin 2026-08-29 01:24:24 0
pSLQ13960 tyrosinase(Priestia megaterium)
 
Resource Report
Resource Website
RRID:Addgene_239454 tyrosinase Other Ampicillin PMID:39095367 Vector Backbone:pUC19; Vector Types:Bacterial Expression, CRISPR, Cell-free system using bacterial extract; Bacterial Resistance:Ampicillin 2026-08-29 01:24:19 0
pDL0_042
 
Resource Report
Resource Website
RRID:Addgene_210766 35S terminator seqeunce Other Spectinomycin PMID:41351300 Please visit https://doi.org/10.1101/2025.06.20.660755 for bioRxiv preprint. Backbone Size:2222; Vector Backbone:pICH41276; Vector Types:Plant Expression, Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-08-29 01:24:19 0
pIF1079
 
Resource Report
Resource Website
RRID:Addgene_237445 SpCas9 Other Ampicillin PMID:41131151 Please visit https://doi.org/10.1101/2024.07.21.604473 for bioRxiv preprint. Backbone Size:5700; Vector Backbone:RT14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:24:21 0
NlChR_mCherry_pcDNA3.1
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_232600 NlChR Other Ampicillin PMID:40970384 Please visit https://doi.org/10.1101/2025.02.24.639930 for bioRxiv preprint. Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:24:31 1
LLP1018
 
Resource Report
Resource Website
RRID:Addgene_239940 CaMV 35S::dCas9 Other Spectinomycin PMID:38769424 Vector Backbone:Binary; Vector Types:Plant Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Spectinomycin N/A 2026-08-29 01:25:30 0
LLP1024
 
Resource Report
Resource Website
RRID:Addgene_239946 CaMV 35S-SynPro-01::Rluc Other Ampicillin PMID:38769424 Vector Backbone:pBluescript SK(+); Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin N/A 2026-08-29 01:25:30 0
SB39
 
Resource Report
Resource Website
RRID:Addgene_235121 Other None PMID:42199375 Genotype: E. coli B F- ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS) ΔendA ΔrecA glvC ::[ phlFAM, cymRAM, luxR, vanRAM, lacIAM, tetR ] Fast growth at 37C in LB (doubling time ~ 20-25 minutes) and improved DNA (endA, recA) and protein stability (lon, ompT). Strain validation: - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 5 518 bp. - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1160(GCTTGTCGACGACGGC) generates a product of 140 bp. - PCR using OR1157 (TACCCCAGTTGGGGCAC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 110 bp. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint. Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None 2026-08-29 01:25:30 0
LLP1015
 
Resource Report
Resource Website
RRID:Addgene_239937 CaMV 35S::dCas9 Other Ampicillin PMID:38769424 Vector Backbone:pBluescript SK(+); Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin N/A 2026-08-29 01:25:30 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.