Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 335 showing 6681 ~ 6700 out of 33,912 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_182587

http://www.addgene.org/182587

Genetic Insert: OEP7
Vector Backbone Description: Vector Backbone:pGWT35S; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28894649

Proper citation: RRID:Addgene_182587 Copy   


  • RRID:Addgene_131020

http://www.addgene.org/131020

Species: Zea mays (maize)
Genetic Insert: MNEAP1
Vector Backbone Description: Backbone Size:4761; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33679862

Proper citation: RRID:Addgene_131020 Copy   


  • RRID:Addgene_183200

http://www.addgene.org/183200

Species: Synthetic
Genetic Insert: Cas9-RFC5
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pDONR221 (2184742_AE175); Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34898428

Proper citation: RRID:Addgene_183200 Copy   


  • RRID:Addgene_131016

http://www.addgene.org/131016

Species: Zea mays (maize)
Genetic Insert: NCH1
Vector Backbone Description: Backbone Size:4761; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33679862

Proper citation: RRID:Addgene_131016 Copy   


http://www.addgene.org/183388

Species: Mus musculus
Genetic Insert: Caspase-1 (AA130-404)
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34734155

Proper citation: RRID:Addgene_183388 Copy   


  • RRID:Addgene_183197

http://www.addgene.org/183197

Species: Synthetic
Genetic Insert: Cas9-POLD3
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pDONR221 (2184742_AE175); Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34898428

Proper citation: RRID:Addgene_183197 Copy   


  • RRID:Addgene_147022

    This resource has 1+ mentions.

http://www.addgene.org/147022

Species: Homo sapiens
Genetic Insert: HsDCP1b
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Sequence extracted from NCBI: NM_152640.3 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147022 Copy   


  • RRID:Addgene_182581

http://www.addgene.org/182581

Species: Synthetic
Genetic Insert: Citrine
Vector Backbone Description: Vector Backbone:pGWT35S; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28894649

Proper citation: RRID:Addgene_182581 Copy   


http://www.addgene.org/184532

Genetic Insert: SARS-CoV-2-NTD-BA.2
Vector Backbone Description: Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35609088
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.12.29.474491v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_184532 Copy   


  • RRID:Addgene_182729

http://www.addgene.org/182729

Species: Synthetic
Genetic Insert: KON206
Vector Backbone Description: Vector Backbone:pGWT35S; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29661017

Proper citation: RRID:Addgene_182729 Copy   


  • RRID:Addgene_182728

http://www.addgene.org/182728

Species: Synthetic
Genetic Insert: KOC169
Vector Backbone Description: Vector Backbone:pGWT35S; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29661017

Proper citation: RRID:Addgene_182728 Copy   


  • RRID:Addgene_183664

http://www.addgene.org/183664

Species: Salmonella enterica serovar Typhimurium
Genetic Insert: sopB
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35484249

Proper citation: RRID:Addgene_183664 Copy   


  • RRID:Addgene_183511

http://www.addgene.org/183511

Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:6035; Vector Backbone:pCMV-tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19046415

Proper citation: RRID:Addgene_183511 Copy   


http://www.addgene.org/167169

Species: Rattus norvegicus
Genetic Insert: APOBEC1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3943; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_167169 Copy   


http://www.addgene.org/183976

Species: Homo sapiens
Genetic Insert: MPP1
Vector Backbone Description: Backbone Marker: Plasmid # 26096; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: SGC Clone Sample ID: MPP1:HPC09T-D06:C210522. SGC link: http://www.thesgc.org/structures/3NEY/

Proper citation: RRID:Addgene_183976 Copy   


http://www.addgene.org/183977

Species: Homo sapiens
Genetic Insert: C22orf4
Vector Backbone Description: Backbone Marker: Plasmid # 26096; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: SGC Clone Sample ID: 'C22orf4:HPC057-F11:C35657. PDB link: https://www.rcsb.org/structure/2QFZ

Proper citation: RRID:Addgene_183977 Copy   


http://www.addgene.org/183981

Species: Homo sapiens
Genetic Insert: TDRD3 in Complex with anti-TDRD3 FAB
Vector Backbone Description: Backbone Marker: Plasmid # 26096; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: SGC Clone Sample ID: TDRD3:JMC006-H10:C42283. SGC link: http://www.thesgc.org/structures/3PNW/

Proper citation: RRID:Addgene_183981 Copy   


  • RRID:Addgene_182740

http://www.addgene.org/182740

Species: streptococcus pyogenes
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pOSIP-HK022; Vector Types:CRISPR, Integrative vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30403660

Proper citation: RRID:Addgene_182740 Copy   


  • RRID:Addgene_184224

http://www.addgene.org/184224

Genetic Insert: ∆RecB (RecB gene was replaced with a kanamycin resistant gene, KanR)
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35390057
Comments: Colony PCR Primers: (1) ATTTCTTCCATCAGGCGGT (2) CAGTCATAGCCGAATAGCCT (3) CGGTGCCCTGAATGAACTGC (4) GTCCCTCTCCGGCATCATGA Expected product size: 661bp with primer (1) and (2), 1035bp with primer (3) and (4). Please visit https://www.biorxiv.org/content/10.1101/2021.11.03.467179v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_184224 Copy   


http://www.addgene.org/184742

Species: Fusicatenibacter Saccharivorans
Genetic Insert: FsRT-Cas1(opt)-Cas2(opt)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3700; Vector Backbone:pET30b+; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35549411

Proper citation: RRID:Addgene_184742 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X