Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 335 showing 6681 ~ 6700 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/48089

Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:4974; Vector Backbone:pGEX-5x3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848

Proper citation: RRID:Addgene_48089 Copy   


http://www.addgene.org/48238

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48238 Copy   


  • RRID:Addgene_48350

http://www.addgene.org/48350

Species: Synthetic
Genetic Insert: EYFP
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2655; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48350 Copy   


  • RRID:Addgene_48233

    This resource has 1+ mentions.

http://www.addgene.org/48233

Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451

Proper citation: RRID:Addgene_48233 Copy   


http://www.addgene.org/48226

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-puro
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48226 Copy   


  • RRID:Addgene_48227

    This resource has 1+ mentions.

http://www.addgene.org/48227

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-neo
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48227 Copy   


  • RRID:Addgene_48348

http://www.addgene.org/48348

Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2655; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48348 Copy   


  • RRID:Addgene_48224

http://www.addgene.org/48224

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP96 activation domain
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48224 Copy   


  • RRID:Addgene_48345

    This resource has 1+ mentions.

http://www.addgene.org/48345

Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2639; Vector Backbone:pDONRP2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48345 Copy   


  • RRID:Addgene_48225

    This resource has 1+ mentions.

http://www.addgene.org/48225

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48225 Copy   


http://www.addgene.org/48346

Species: Synthetic
Genetic Insert: V5 and 6xHis epitope tags cassette
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2645; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48346 Copy   


http://www.addgene.org/48228

Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR4; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48228 Copy   


  • RRID:Addgene_48223

    This resource has 1+ mentions.

http://www.addgene.org/48223

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP64 activation domain
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48223 Copy   


  • RRID:Addgene_48344

http://www.addgene.org/48344

Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2646; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834

Proper citation: RRID:Addgene_48344 Copy   


  • RRID:Addgene_48221

    This resource has 1+ mentions.

http://www.addgene.org/48221

Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2799; Vector Backbone:pCR8/GW/TOPO; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48221 Copy   


  • RRID:Addgene_48336

http://www.addgene.org/48336

Species: Photinus pyralis
Genetic Insert: firely luciferase
Vector Backbone Description: Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29578409

Proper citation: RRID:Addgene_48336 Copy   


  • RRID:Addgene_48337

    This resource has 1+ mentions.

http://www.addgene.org/48337

Species: Photinus pyralis
Genetic Insert: firely luciferase
Vector Backbone Description: Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20644616

Proper citation: RRID:Addgene_48337 Copy   


  • RRID:Addgene_48339

http://www.addgene.org/48339

Species: Mus musculus
Genetic Insert: 5-hydroxytriptamine receptor isoform 6
Vector Backbone Description: Backbone Size:5300; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056873

Proper citation: RRID:Addgene_48339 Copy   


http://www.addgene.org/48293

Vector Backbone Description: Backbone Size:4729; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a MYFQSNA fusion tag on the N-terminus To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ Note: The plasmid as it is provided enocdes "MYFQSNI". However, the vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA.

Proper citation: RRID:Addgene_48293 Copy   


http://www.addgene.org/48299

Vector Backbone Description: Backbone Size:9643; Vector Backbone:pRS422; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Ade auxotrophy. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48299 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X