Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: OEP7
Vector Backbone Description: Vector Backbone:pGWT35S; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28894649
Proper citation: RRID:Addgene_182587 Copy
Species: Zea mays (maize)
Genetic Insert: MNEAP1
Vector Backbone Description: Backbone Size:4761; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33679862
Proper citation: RRID:Addgene_131020 Copy
Species: Synthetic
Genetic Insert: Cas9-RFC5
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pDONR221 (2184742_AE175); Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34898428
Proper citation: RRID:Addgene_183200 Copy
Species: Zea mays (maize)
Genetic Insert: NCH1
Vector Backbone Description: Backbone Size:4761; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33679862
Proper citation: RRID:Addgene_131016 Copy
Species: Mus musculus
Genetic Insert: Caspase-1 (AA130-404)
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34734155
Proper citation: RRID:Addgene_183388 Copy
Species: Synthetic
Genetic Insert: Cas9-POLD3
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pDONR221 (2184742_AE175); Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34898428
Proper citation: RRID:Addgene_183197 Copy
Species: Homo sapiens
Genetic Insert: HsDCP1b
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Sequence extracted from NCBI: NM_152640.3 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147022 Copy
Species: Synthetic
Genetic Insert: Citrine
Vector Backbone Description: Vector Backbone:pGWT35S; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28894649
Proper citation: RRID:Addgene_182581 Copy
Genetic Insert: SARS-CoV-2-NTD-BA.2
Vector Backbone Description: Vector Backbone:pVRC8400; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35609088
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.12.29.474491v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_184532 Copy
Species: Synthetic
Genetic Insert: KON206
Vector Backbone Description: Vector Backbone:pGWT35S; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29661017
Proper citation: RRID:Addgene_182729 Copy
Species: Synthetic
Genetic Insert: KOC169
Vector Backbone Description: Vector Backbone:pGWT35S; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29661017
Proper citation: RRID:Addgene_182728 Copy
Species: Salmonella enterica serovar Typhimurium
Genetic Insert: sopB
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35484249
Proper citation: RRID:Addgene_183664 Copy
Vector Backbone Description: Backbone Marker:Agilent; Backbone Size:6035; Vector Backbone:pCMV-tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19046415
Proper citation: RRID:Addgene_183511 Copy
Species: Rattus norvegicus
Genetic Insert: APOBEC1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3943; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_167169 Copy
Species: Homo sapiens
Genetic Insert: MPP1
Vector Backbone Description: Backbone Marker: Plasmid # 26096; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: SGC Clone Sample ID: MPP1:HPC09T-D06:C210522. SGC link: http://www.thesgc.org/structures/3NEY/
Proper citation: RRID:Addgene_183976 Copy
Species: Homo sapiens
Genetic Insert: C22orf4
Vector Backbone Description: Backbone Marker: Plasmid # 26096; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: SGC Clone Sample ID: 'C22orf4:HPC057-F11:C35657. PDB link: https://www.rcsb.org/structure/2QFZ
Proper citation: RRID:Addgene_183977 Copy
Species: Homo sapiens
Genetic Insert: TDRD3 in Complex with anti-TDRD3 FAB
Vector Backbone Description: Backbone Marker: Plasmid # 26096; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: SGC Clone Sample ID: TDRD3:JMC006-H10:C42283. SGC link: http://www.thesgc.org/structures/3PNW/
Proper citation: RRID:Addgene_183981 Copy
Species: streptococcus pyogenes
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pOSIP-HK022; Vector Types:CRISPR, Integrative vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30403660
Proper citation: RRID:Addgene_182740 Copy
Genetic Insert: ∆RecB (RecB gene was replaced with a kanamycin resistant gene, KanR)
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35390057
Comments: Colony PCR Primers:
(1) ATTTCTTCCATCAGGCGGT
(2) CAGTCATAGCCGAATAGCCT
(3) CGGTGCCCTGAATGAACTGC
(4) GTCCCTCTCCGGCATCATGA
Expected product size: 661bp with primer (1) and (2), 1035bp with primer (3) and (4).
Please visit https://www.biorxiv.org/content/10.1101/2021.11.03.467179v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_184224 Copy
Species: Fusicatenibacter Saccharivorans
Genetic Insert: FsRT-Cas1(opt)-Cas2(opt)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3700; Vector Backbone:pET30b+; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35549411
Proper citation: RRID:Addgene_184742 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
