Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: UDP-N-acetylhexosamine pyrophosphorylase
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSin4 EF1a IRES Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34288588
Comments: This plasmid was generated in the lab a long time ago and we cannot locate detailed cloning information at this point.
Proper citation: RRID:Addgene_169891 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting ACO1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: CCACTACCCCAACCTGGCGG
Proper citation: RRID:Addgene_169892 Copy
Species: Homo sapiens
Genetic Insert: Vangl2/Strabismus
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2P+; Vector Types:Xenopus Expression; Bacterial Resistance:Ampicillin
Comments: This is a wild type human VANGL2/Strabismuus, cloned into pCS2P+. Injected RNA in zebrafish embryos gives the expected convergent/extension phenotype (Chris Thorpe, unpub. observations).
Reference: Made by Yan Zhang by PCR for RTM. Cloned as a Cla1-Xho1 insert.
Proper citation: RRID:Addgene_16992 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting IREB2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Comments: Target: AATGCACCAAATCCTGGAGG
Proper citation: RRID:Addgene_169894 Copy
Species: Homo sapiens
Genetic Insert: TFRC
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pMXS-IRES-BLAST; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34039609
Proper citation: RRID:Addgene_169890 Copy
Species: Homo sapiens
Genetic Insert: sgAAT Nicking
Vector Backbone Description: Vector Backbone:pmd127; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33837189
Comments: Please visit https://doi.org/10.1101/2020.12.15.422970 for bioRxiv preprint.
Proper citation: RRID:Addgene_169842 Copy
Species: SARS coronavirus 2
Genetic Insert: Protein S
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:10381; Vector Backbone:pCEP4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35046611
Proper citation: RRID:Addgene_169848 Copy
Species: Xenopus laevis
Genetic Insert: Goosecoid
Vector Backbone Description: Backbone Size:3000; Vector Backbone:SP64T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Insert: coding region of Xenopus goosecoid in SP64T in sense (#9) & antisense (#2) orientation.
Transcription: linearize with EcoR1 and transcribe with SP6.
Plasmid History:
Constructed by Jan Christian by PCR.
Goosecoid cloned and characterized by lab of E. DeRobertis, UCLA.
Proper citation: RRID:Addgene_16979 Copy
Species: Mus musculus
Genetic Insert: safe harbor sgRNA
Vector Backbone Description: Backbone Size:8907; Vector Backbone:pMCB320; Vector Types:Mammalian Expression, Mouse Targeting, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33157015
Proper citation: RRID:Addgene_169834 Copy
Species: Xenopus laevis
Genetic Insert: Xbra
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2500; Vector Backbone:psp73; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Insert: full length Xbra from Jim Smith.
Antisense: linearize with EcoRV, transcribe with T7.
Plasmid History:
Constructed by Jan Christian.
Proper citation: RRID:Addgene_16978 Copy
Species: Homo sapiens
Genetic Insert: guide RNA for KLF7 neighbouring region
Vector Backbone Description: Backbone Marker:Addgene Plasmid #52961; Backbone Size:12993; Vector Backbone:LentiCRISPRv2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30733539
Proper citation: RRID:Addgene_169797 Copy
Species: Homo sapiens
Genetic Insert: Donor sequence to ACTB gene for HR
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2959; Vector Backbone:pBlueScript II SK (+); Vector Types:HR donor vector for human ACTB gene.; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30733539
Proper citation: RRID:Addgene_169798 Copy
Species: Synthetic
Genetic Insert: OxLight1
Vector Backbone Description: Backbone Marker:Viral Vector Facility - University of Zurich; Backbone Size:4438; Vector Backbone:pAAV.hSynapsin1; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35145320
Proper citation: RRID:Addgene_169792 Copy
Genetic Insert: Scrambled guide RNA
Vector Backbone Description: Backbone Marker:Addgene Plasmid #52961; Backbone Size:12993; Vector Backbone:LentiCRISPRv2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30733539
Proper citation: RRID:Addgene_169795 Copy
Species: Francisella tularensis subsp. novicida
Genetic Insert: FnCas12a
Vector Backbone Description: Backbone Size:4447; Vector Backbone:pNW33n; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:33538626
Proper citation: RRID:Addgene_169838 Copy
Vector Backbone Description: Backbone Size:6529; Vector Backbone:pPIDCB2; Vector Types:Mammalian Expression, Avian expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32917762
Comments: Use AflII and PstI restriction sites for cloning. This plasmid is identical to pPIDNB2 except it has replaced the mNeonGreen sequence in pPIDNB2, which requires a paid Allele Biotech license, with mClover3, which doesn't require a paid license.
Proper citation: RRID:Addgene_169900 Copy
Species: Synthetic
Genetic Insert: tetR-P2A-eGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6113; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34226556
Comments: Note that although the plasmid encodes a hygromycin resistance gene, it is not expressed from the plasmid. It is only expressed after Flp recombinase-mediated chromosomal integration of the plasmid.
Proper citation: RRID:Addgene_169747 Copy
Vector Backbone Description: Backbone Size:6916; Vector Backbone:pPIDNB2; Vector Types:Mammalian Expression, Avian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32917762
Comments: Use AflII and PstI restriction sites for cloning. This plasmid contains mNeonGreen, which requires a paid license. See pPIDCB2 for an alternative plasmid, which has replaced the mNeongreen with mClover3 and does not require a paid license.
Proper citation: RRID:Addgene_169902 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: U6 U57A
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4783; Vector Backbone:pRS314; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33547186
Comments: Please note that this plasmid contains an additional IS4-like element ISVsa5 family transposase compared to the pRS314 backbone.
Proper citation: RRID:Addgene_169927 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: U6 U57C
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4783; Vector Backbone:pRS314; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33547186
Comments: Please note that this plasmid contains an additional IS4-like element ISVsa5 family transposase compared to the pRS314 backbone.
Proper citation: RRID:Addgene_169928 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.