Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 336 showing 6701 ~ 6720 out of 30,517 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/99687

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99687 Copy   


http://www.addgene.org/99686

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99686 Copy   


http://www.addgene.org/99689

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99689 Copy   


http://www.addgene.org/99688

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99688 Copy   


  • RRID:Addgene_99651

http://www.addgene.org/99651

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_99651 Copy   


  • RRID:Addgene_99654

http://www.addgene.org/99654

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99654 Copy   


  • RRID:Addgene_99655

http://www.addgene.org/99655

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99655 Copy   


  • RRID:Addgene_99657

http://www.addgene.org/99657

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99657 Copy   


  • RRID:Addgene_99659

http://www.addgene.org/99659

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99659 Copy   


  • RRID:Addgene_99663

http://www.addgene.org/99663

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99663 Copy   


  • RRID:Addgene_99664

http://www.addgene.org/99664

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99664 Copy   


  • RRID:Addgene_99666

http://www.addgene.org/99666

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99666 Copy   


  • RRID:Addgene_99669

http://www.addgene.org/99669

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pBR322; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.

Proper citation: RRID:Addgene_99669 Copy   


http://www.addgene.org/99630

Species: Synthetic
Genetic Insert: N-PhiM
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28802047
Comments: Please note that a 2bp insertion at start of FRT site was found during Addgene's Quality Control process. The depositing lab has noted that the FRT site is now non functional in the presence of FlpO enzyme. However in the case of this plasmid, the FRT site is not required for the plasmid to be functional, since no FlipOUT (FlpO) is going to be used.

Proper citation: RRID:Addgene_99630 Copy   


http://www.addgene.org/99696

Species: Synthetic
Genetic Insert: dCas9 and gRNA targeting Afp
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_99696 Copy   


http://www.addgene.org/99697

Species: Synthetic
Genetic Insert: dCas9 and gRNA targeting Afp
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA: CTAACTTCAACGTAAGGAAA

Proper citation: RRID:Addgene_99697 Copy   


http://www.addgene.org/99615

Species: Synthetic
Genetic Insert: Mb2-HA-mTfp1
Vector Backbone Description: Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28802047

Proper citation: RRID:Addgene_99615 Copy   


  • RRID:Addgene_99751

    This resource has 1+ mentions.

http://www.addgene.org/99751

Species: Synthetic
Genetic Insert: HIs-H2B-Cherry, H2B-EGFP, HA-H2B-Cerulean
Vector Backbone Description: Vector Backbone:pBlueScript KS; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28802047

Proper citation: RRID:Addgene_99751 Copy   


  • RRID:Addgene_99750

    This resource has 1+ mentions.

http://www.addgene.org/99750

Species: Synthetic
Genetic Insert: Mb2YFP-2A, Mb2Tomato-2A, Mb2-HA-Tfp1
Vector Backbone Description: Vector Backbone:pBlueScript KS; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28802047
Comments: Please note that several discrepancies were found between Addgene's quality control and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

Proper citation: RRID:Addgene_99750 Copy   


  • RRID:Addgene_99874

http://www.addgene.org/99874

Species: Synthetic
Genetic Insert: CcadTSMod
Vector Backbone Description: Vector Backbone:pT7TS; Vector Types:Xenopus Microinjection; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28327558

Proper citation: RRID:Addgene_99874 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X