Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

328,858 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
CMVTCRa_candidate5
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_164999 TRAV Homo sapiens Ampicillin PMID:33483338 Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:09:26 1
CMVTCRa_candidate2
 
Resource Report
Resource Website
RRID:Addgene_164997 TRAV Homo sapiens Ampicillin PMID:33483338 Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:09:26 0
aav-tnt-dnmrtfa-gfp
 
Resource Report
Resource Website
RRID:Addgene_165035 dnMRTFA Mus musculus Ampicillin PMID:33361330 Vector Backbone:aav-tnt-gfp-v2; Vector Types:AAV; Bacterial Resistance:Ampicillin deletion of 100 N-terminal amino acids 2026-08-15 01:09:26 0
pCAG-TWIN-STREP-FLAG-NPRL3
 
Resource Report
Resource Website
RRID:Addgene_164984 NPRL3 Homo sapiens Ampicillin PMID:31672913 Backbone Size:4960; Vector Backbone:pCAG TWIN STREP FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:26 0
aav-tnt-wtmrtfa-gfp
 
Resource Report
Resource Website
RRID:Addgene_165037 Mrtfa Mus musculus Ampicillin PMID:33361330 Please note that the Addgene verified sequence detected a 22bp deletion in the ITR region. This deletion does not affect plasmid function. Vector Backbone:aav-tnt-gfp-v2; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:09:26 0
pCRII Pig5
 
Resource Report
Resource Website
RRID:Addgene_16499 Pig5 Homo sapiens Ampicillin PMID:9305847 Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Partial cDNA clone 2026-08-15 01:09:26 0
pLJM1-Flag-Rheb
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_165031 Rheb Homo sapiens Ampicillin PMID:33157014 Backbone Marker:Available at Addgene (#19319); Backbone Size:7400; Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:09:26 1
mCh-LaGFP(N)-cpFRB2-T2A-FKBP-LaGFP(C)
 
Resource Report
Resource Website
RRID:Addgene_165030 LaGFP(N)-cpFRB2-T2A-FKBP-LaGFP(C) Synthetic Ampicillin PMID:32277990 Backbone Size:5646; Vector Backbone:pTriEX; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:09:26 0
pIR3DH8
 
Resource Report
Resource Website
RRID:Addgene_165068 gal80Arm1-P-AgTEF1-KlURA3-T-AgTEF1-gal80Arm2 Other Ampicillin PMID:33594068 Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin WT 2026-08-15 01:09:27 0
pIR3DH8K
 
Resource Report
Resource Website
RRID:Addgene_165069 gal80Arm1-P-TPI1-KanMX4-gal80Arm2 Other Ampicillin PMID:33594068 Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin WT 2026-08-15 01:09:27 0
pJT9RFR
 
Resource Report
Resource Website
RRID:Addgene_165067 T-RPL3>ERG20>P-GAL1-P-GAL2>Y-FAST>ErB1.2A-AcNES1>T-RPL41B Other Ampicillin PMID:33594068 Please note Addgene NGS result identified several mutations in LEU2- V73A, A82G, L199V, D304N. Depositor confirms this does not affect plasmid function. On the contrary the depositor has found "significant improvement on the productivities in the strain harbouring this plasmid." Vector Backbone:pRS425; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin WT 2026-08-15 01:09:27 0
pCRII Pig9
 
Resource Report
Resource Website
RRID:Addgene_16503 Pig9 Homo sapiens Ampicillin PMID:9305847 Backbone Marker:Invitrogen; Backbone Size:3900; Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Partial cDNA clone 2026-08-15 01:09:26 0
Vg4-Luc
 
Resource Report
Resource Website
RRID:Addgene_16501 Mad-binding element from Vg Ampicillin PMID:9660945 Four copies of the Mad-binding element from Vg (GCTTGGACTGCCGTCGCGATTC) are cloned into pGL3. Backbone Marker:Promega; Backbone Size:5010; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:09:26 0
pISKP1-TIR1
 
Resource Report
Resource Website
RRID:Addgene_165061 P-URA3>KlURA3>T-AgTEF1- T-PGK1-P-ACS2> SKP1>OsTIR1opt>T-URA3 Other Ampicillin PMID:33594068 Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin WT 2026-08-15 01:09:27 0
pILGFP1F5
 
Resource Report
Resource Website
RRID:Addgene_165064 P-URA3>KlURA3>T-AgTEF1-P-TEF1> (BamHI)yEGFP>T-PGK1-T-URA3 Other Ampicillin PMID:33594068 Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin WT 2026-08-15 01:09:27 0
pJT11F
 
Resource Report
Resource Website
RRID:Addgene_165062 T-RPL3>ERG20-N127W>P-GAL1-P-GAL10>Y-FAST>T-ALD6-P-GAL2>ClLS>T-RPL41B Other Ampicillin PMID:33594068 Vector Backbone:pRS425; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin WT 2026-08-15 01:09:27 0
CMVTCRb_candidate6
 
Resource Report
Resource Website
RRID:Addgene_165002 TRB Homo sapiens Ampicillin PMID:33483338 Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:09:26 0
CMVTCRa_candidate6
 
Resource Report
Resource Website
RRID:Addgene_165001 TRAV Homo sapiens Ampicillin PMID:33483338 Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:09:26 0
CMVTCRb_candidate8
 
Resource Report
Resource Website
RRID:Addgene_165006 TRB Homo sapiens Ampicillin PMID:33483338 Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:09:26 0
CMVTCRa_candidate10
 
Resource Report
Resource Website
RRID:Addgene_165007 TRAV Homo sapiens Ampicillin PMID:33483338 Backbone Size:9531; Vector Backbone:pLX301 (Addgene #25895); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:09:26 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.